Incidental Mutation 'R0667:Tjp2'
ID218566
Institutional Source Beutler Lab
Gene Symbol Tjp2
Ensembl Gene ENSMUSG00000024812
Gene Nametight junction protein 2
SynonymsZO-2
MMRRC Submission 038852-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0667 (G1)
Quality Score60
Status Validated
Chromosome19
Chromosomal Location24094523-24225026 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24108749 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 803 (V803A)
Ref Sequence ENSEMBL: ENSMUSP00000097154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099558]
PDB Structure
Solution structure of N-terminal PDZ domain from mouse TJP2 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000099558
AA Change: V803A

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097154
Gene: ENSMUSG00000024812
AA Change: V803A

DomainStartEndE-ValueType
PDZ 19 97 1.25e-15 SMART
low complexity region 163 178 N/A INTRINSIC
low complexity region 181 202 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 253 276 N/A INTRINSIC
PDZ 297 365 8.73e-15 SMART
low complexity region 377 390 N/A INTRINSIC
PDZ 499 572 1.57e-16 SMART
SH3 587 648 1.07e-2 SMART
GuKc 672 861 3.25e-42 SMART
low complexity region 969 980 N/A INTRINSIC
low complexity region 1037 1049 N/A INTRINSIC
coiled coil region 1063 1090 N/A INTRINSIC
Meta Mutation Damage Score 0.1998 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zonula occluden that is a member of the membrane-associated guanylate kinase homolog family. The encoded protein functions as a component of the tight junction barrier in epithelial and endothelial cells and is necessary for proper assembly of tight junctions. Mutations in this gene have been identified in patients with hypercholanemia, and genomic duplication of a 270 kb region including this gene causes autosomal dominant deafness-51. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in lethality shortly after implantation due to arrest in early gastrulation. Structure and permeability barrier of the apical junctional complex are altered in cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C G 7: 140,261,537 S251R possibly damaging Het
Abca5 G T 11: 110,327,811 N76K probably benign Het
Adamts12 C T 15: 11,215,624 R244C probably damaging Het
Atad2 A G 15: 58,098,719 S1143P probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Cand1 A G 10: 119,216,520 S234P probably benign Het
Cd200 T A 16: 45,394,857 I144L probably benign Het
Cep76 A T 18: 67,634,778 L228Q possibly damaging Het
Col12a1 A G 9: 79,628,462 L2584S probably damaging Het
Col6a3 A C 1: 90,828,101 D155E probably damaging Het
Col6a4 G A 9: 106,029,959 probably benign Het
Dsg2 A C 18: 20,573,499 D24A possibly damaging Het
Gm5901 G A 7: 105,377,490 S155N possibly damaging Het
Hkdc1 T C 10: 62,411,865 probably benign Het
Kansl1 A G 11: 104,343,538 V714A probably benign Het
Kcnh1 T A 1: 192,506,038 S936T probably benign Het
Klhdc3 A T 17: 46,677,225 F205I probably benign Het
Krt31 T A 11: 100,048,125 H290L probably benign Het
Lama2 T A 10: 27,344,410 probably null Het
Mep1a T G 17: 43,478,190 D565A probably benign Het
Mgme1 T A 2: 144,278,987 probably benign Het
Mtf2 C T 5: 108,104,503 T409I probably damaging Het
Mylk3 A G 8: 85,355,165 probably null Het
Myo1c A G 11: 75,668,512 E650G probably damaging Het
Nipbl A C 15: 8,361,004 D260E possibly damaging Het
Nufip2 T A 11: 77,692,013 V251D possibly damaging Het
Olfr1239 T C 2: 89,417,688 I242V probably benign Het
Olfr138 C A 17: 38,275,157 P129T probably damaging Het
Olfr855 T A 9: 19,585,447 N303K probably benign Het
Osm G T 11: 4,239,918 R234L possibly damaging Het
Pabpc1 G A 15: 36,598,031 A515V probably benign Het
Piwil1 T A 5: 128,741,478 probably null Het
Pld1 A G 3: 28,079,178 probably null Het
Plekhg3 C T 12: 76,576,598 R871C probably damaging Het
Ppfia2 A T 10: 106,913,694 Y1147F probably damaging Het
Prmt3 A G 7: 49,791,995 Y240C probably damaging Het
Prr36 G T 8: 4,216,311 probably benign Het
Ptprd A G 4: 75,957,346 I908T probably damaging Het
Sae1 A T 7: 16,368,532 N172K probably damaging Het
Satb1 T G 17: 51,782,861 Q319H probably damaging Het
Scn2a A T 2: 65,751,996 I1563F possibly damaging Het
Scn3a C A 2: 65,484,411 R1102L probably null Het
Serpinb9b T A 13: 33,032,926 L60* probably null Het
Setd1a A G 7: 127,786,593 D281G probably damaging Het
Slc8a1 C A 17: 81,648,881 V243F probably damaging Het
Tgfbr3 A T 5: 107,177,850 H115Q probably benign Het
Tiam1 C A 16: 89,897,984 S195I probably damaging Het
Ttc5 T A 14: 50,765,958 Q423L probably benign Het
Tyk2 A C 9: 21,108,871 V997G probably damaging Het
Uhrf1 T C 17: 56,310,677 V133A probably benign Het
Vmn2r107 A C 17: 20,355,654 Y82S possibly damaging Het
Vmn2r93 T C 17: 18,326,241 F792L probably damaging Het
Vps13c G A 9: 67,951,573 W2768* probably null Het
Zfp456 A T 13: 67,366,742 C282S probably benign Het
Zhx1 T C 15: 58,053,165 N562D possibly damaging Het
Zmynd15 G T 11: 70,465,118 G481C probably damaging Het
Other mutations in Tjp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Tjp2 APN 19 24138810 missense possibly damaging 0.89
IGL01412:Tjp2 APN 19 24100775 missense probably damaging 0.99
IGL01681:Tjp2 APN 19 24134849 critical splice donor site probably null
IGL02044:Tjp2 APN 19 24120840 missense probably damaging 1.00
IGL02212:Tjp2 APN 19 24138786 missense probably damaging 1.00
IGL02629:Tjp2 APN 19 24122379 splice site probably benign
IGL02819:Tjp2 APN 19 24114105 missense probably damaging 0.98
IGL02931:Tjp2 APN 19 24096632 missense probably benign 0.11
PIT4402001:Tjp2 UTSW 19 24098129 nonsense probably null
R0032:Tjp2 UTSW 19 24108695 missense probably damaging 1.00
R0674:Tjp2 UTSW 19 24131316 missense probably benign 0.37
R0749:Tjp2 UTSW 19 24122272 missense possibly damaging 0.67
R1185:Tjp2 UTSW 19 24131163 missense possibly damaging 0.67
R1185:Tjp2 UTSW 19 24131163 missense possibly damaging 0.67
R1185:Tjp2 UTSW 19 24131163 missense possibly damaging 0.67
R1563:Tjp2 UTSW 19 24132703 missense probably damaging 0.99
R1571:Tjp2 UTSW 19 24100875 missense probably damaging 1.00
R1624:Tjp2 UTSW 19 24131412 missense probably benign 0.01
R1658:Tjp2 UTSW 19 24112947 missense probably damaging 0.99
R1851:Tjp2 UTSW 19 24099535 missense possibly damaging 0.67
R1968:Tjp2 UTSW 19 24111073 missense probably damaging 0.99
R2068:Tjp2 UTSW 19 24122323 missense probably benign 0.22
R2273:Tjp2 UTSW 19 24112807 missense probably benign
R2994:Tjp2 UTSW 19 24112851 missense probably damaging 1.00
R3767:Tjp2 UTSW 19 24100826 missense probably benign 0.01
R3770:Tjp2 UTSW 19 24100826 missense probably benign 0.01
R4077:Tjp2 UTSW 19 24108818 missense possibly damaging 0.90
R4079:Tjp2 UTSW 19 24108818 missense possibly damaging 0.90
R4505:Tjp2 UTSW 19 24108831 missense possibly damaging 0.50
R4720:Tjp2 UTSW 19 24100805 missense probably damaging 1.00
R4739:Tjp2 UTSW 19 24120111 intron probably null
R4745:Tjp2 UTSW 19 24096666 missense possibly damaging 0.56
R4858:Tjp2 UTSW 19 24122120 missense probably damaging 1.00
R5290:Tjp2 UTSW 19 24131204 missense probably benign
R5887:Tjp2 UTSW 19 24096599 missense probably benign
R5988:Tjp2 UTSW 19 24114100 missense probably benign
R6144:Tjp2 UTSW 19 24120073 missense probably damaging 0.99
R6163:Tjp2 UTSW 19 24125704 critical splice donor site probably null
R6183:Tjp2 UTSW 19 24100791 missense probably damaging 0.99
R6242:Tjp2 UTSW 19 24099603 intron probably null
R6683:Tjp2 UTSW 19 24120843 missense probably damaging 0.99
R6866:Tjp2 UTSW 19 24101991 missense probably damaging 0.99
R7025:Tjp2 UTSW 19 24132688 missense probably benign 0.28
R7153:Tjp2 UTSW 19 24101981 missense probably benign 0.40
R7514:Tjp2 UTSW 19 24111522 missense probably benign 0.03
R8004:Tjp2 UTSW 19 24114120 missense probably damaging 1.00
X0066:Tjp2 UTSW 19 24098027 missense probably damaging 1.00
Z1176:Tjp2 UTSW 19 24131365 missense probably benign 0.00
Z1177:Tjp2 UTSW 19 24095460 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- AGTCTACCTCGGAAATCTAGCGCC -3'
(R):5'- TGGGAGAATAGACCCCTCAGTGATG -3'

Sequencing Primer
(F):5'- CCACGGTATCAACTATTCTTGAACG -3'
(R):5'- AATAGACCCCTCAGTGATGTCTTTG -3'
Posted On2014-08-18