Incidental Mutation 'R0674:Vsig10'
ID218577
Institutional Source Beutler Lab
Gene Symbol Vsig10
Ensembl Gene ENSMUSG00000066894
Gene NameV-set and immunoglobulin domain containing 10
Synonyms
MMRRC Submission 038859-MU
Accession Numbers

Genbank: NM_001033311; MGI: 2448533

Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R0674 (G1)
Quality Score67
Status Validated
Chromosome5
Chromosomal Location117319083-117355005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 117343846 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 367 (T367M)
Ref Sequence ENSEMBL: ENSMUSP00000107598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086464] [ENSMUST00000111967]
Predicted Effect probably damaging
Transcript: ENSMUST00000086464
AA Change: T340M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083655
Gene: ENSMUSG00000066894
AA Change: T340M

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
IG 23 114 4.03e-8 SMART
IG 132 214 9.49e-5 SMART
Pfam:Ig_2 215 300 2.6e-2 PFAM
Pfam:Ig_3 216 284 3.5e-4 PFAM
IGc2 313 384 1.12e-6 SMART
transmembrane domain 403 425 N/A INTRINSIC
coiled coil region 446 481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111967
AA Change: T367M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107598
Gene: ENSMUSG00000066894
AA Change: T367M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 50 141 4.03e-8 SMART
IG 159 241 9.49e-5 SMART
Blast:IG_like 248 327 2e-33 BLAST
IGc2 340 411 1.12e-6 SMART
transmembrane domain 430 452 N/A INTRINSIC
coiled coil region 473 508 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147182
SMART Domains Protein: ENSMUSP00000125808
Gene: ENSMUSG00000066894

DomainStartEndE-ValueType
Blast:IG_like 1 41 3e-14 BLAST
IGc2 54 125 1.12e-6 SMART
transmembrane domain 144 166 N/A INTRINSIC
coiled coil region 187 222 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 90.4%
Validation Efficiency 97% (124/128)
Allele List at MGI

All alleles(11) : Gene trapped(11)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 37,044,626 V1134E possibly damaging Het
Adar A G 3: 89,749,823 probably benign Het
Adgrl2 A T 3: 148,837,679 M803K possibly damaging Het
Atp13a5 T C 16: 29,248,350 probably benign Het
Atp2a3 T C 11: 72,981,885 I753T probably damaging Het
Bace2 G A 16: 97,436,749 V467M possibly damaging Het
Ccser2 A G 14: 36,918,591 C11R possibly damaging Het
Cd2ap T A 17: 42,845,392 I85F possibly damaging Het
Cd2bp2 C T 7: 127,194,836 E94K probably damaging Het
Chrna3 C A 9: 55,015,172 A451S probably damaging Het
Cmya5 C A 13: 93,092,791 V1930F probably damaging Het
Csmd1 T C 8: 16,000,550 T2229A probably benign Het
Csrnp2 A T 15: 100,487,991 L122H probably damaging Het
Cyp11b2 G A 15: 74,855,544 P96L probably damaging Het
Ddr1 G T 17: 35,689,669 S368* probably null Het
E2f1 T C 2: 154,564,109 K115E probably damaging Het
Erlec1 A T 11: 30,935,073 probably benign Het
Fus T A 7: 127,972,776 probably benign Het
Gml G A 15: 74,813,860 T92I probably damaging Het
Herc1 T C 9: 66,501,192 S4567P probably damaging Het
Iglc2 A G 16: 19,198,841 S5P probably benign Het
Itgam T C 7: 128,116,218 V1028A possibly damaging Het
Krt222 T A 11: 99,236,260 N178I probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Luzp1 C T 4: 136,543,457 T997I possibly damaging Het
Maml1 G T 11: 50,258,058 Q952K probably benign Het
Map2 A G 1: 66,413,202 E499G probably damaging Het
Map4k4 A T 1: 40,003,815 H118L probably damaging Het
Myzap T C 9: 71,515,144 D382G probably damaging Het
Naip5 T C 13: 100,223,199 T510A probably benign Het
Nek6 G C 2: 38,558,904 G95R possibly damaging Het
Nphp3 T C 9: 104,036,282 probably null Het
Nr1d2 T C 14: 18,215,086 S309G probably benign Het
Nrcam A T 12: 44,564,322 I570F probably benign Het
Oas1d T C 5: 120,919,986 I331T probably benign Het
Olfr1306 A T 2: 111,912,673 F86I probably benign Het
Olfr65 T C 7: 103,907,255 V272A probably benign Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pex5l A T 3: 32,952,616 W535R probably damaging Het
Pisd C T 5: 32,774,437 R202H probably benign Het
Plxna2 A G 1: 194,649,475 N403S probably benign Het
Prdm12 A G 2: 31,643,912 I180M probably benign Het
Prpf6 A G 2: 181,631,974 T304A probably benign Het
Ptprm G A 17: 67,191,341 T35I possibly damaging Het
Ptx3 T A 3: 66,224,727 I223N probably damaging Het
Pygb G A 2: 150,815,134 probably null Het
Qrsl1 A G 10: 43,896,001 probably benign Het
Rad51ap2 T C 12: 11,458,817 probably null Het
Ralbp1 C T 17: 65,852,753 R505H probably benign Het
Rimbp3 T C 16: 17,212,737 S1342P probably benign Het
Slc22a14 C A 9: 119,178,542 R267L probably damaging Het
Slco6c1 T A 1: 97,104,773 probably benign Het
Tcp1 T C 17: 12,923,244 I375T probably damaging Het
Tiparp T C 3: 65,553,165 I525T probably benign Het
Tjp2 A G 19: 24,131,316 L144P probably benign Het
Tssk2 A G 16: 17,899,066 D111G probably benign Het
Ttn T C 2: 76,945,479 T1740A possibly damaging Het
Vmn2r102 T A 17: 19,677,867 D381E probably benign Het
Wnt11 T C 7: 98,846,528 C80R probably damaging Het
Zar1 T A 5: 72,580,300 probably null Het
Zfp52 A T 17: 21,561,846 H652L probably damaging Het
Zpr1 T A 9: 46,275,449 L194Q probably damaging Het
Other mutations in Vsig10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Vsig10 APN 5 117338414 missense probably benign 0.00
IGL00340:Vsig10 APN 5 117351587 missense probably benign 0.03
IGL01082:Vsig10 APN 5 117334905 missense probably benign 0.33
IGL01285:Vsig10 APN 5 117324889 missense probably benign 0.43
IGL01790:Vsig10 APN 5 117338314 missense probably damaging 1.00
IGL03004:Vsig10 APN 5 117325075 missense probably damaging 1.00
D3080:Vsig10 UTSW 5 117343819 missense probably damaging 1.00
R0101:Vsig10 UTSW 5 117335069 critical splice donor site probably null
R0403:Vsig10 UTSW 5 117338461 missense probably benign 0.05
R1437:Vsig10 UTSW 5 117351570 missense probably damaging 0.96
R1689:Vsig10 UTSW 5 117352760 missense probably benign 0.00
R1710:Vsig10 UTSW 5 117351654 missense probably benign
R1765:Vsig10 UTSW 5 117318815 unclassified probably benign
R4422:Vsig10 UTSW 5 117324921 missense probably benign 0.00
R4541:Vsig10 UTSW 5 117352816 utr 3 prime probably benign
R4909:Vsig10 UTSW 5 117338243 missense probably benign 0.31
R4999:Vsig10 UTSW 5 117343975 missense probably damaging 1.00
R5855:Vsig10 UTSW 5 117338270 missense probably damaging 1.00
R5866:Vsig10 UTSW 5 117352749 critical splice acceptor site probably null
R6214:Vsig10 UTSW 5 117343924 missense probably damaging 1.00
R6418:Vsig10 UTSW 5 117348296 missense probably benign 0.03
R6505:Vsig10 UTSW 5 117351759 missense possibly damaging 0.95
R6854:Vsig10 UTSW 5 117338407 missense probably benign 0.36
R7121:Vsig10 UTSW 5 117343902 missense probably damaging 1.00
R7596:Vsig10 UTSW 5 117334783 missense possibly damaging 0.46
R8066:Vsig10 UTSW 5 117351784 missense probably benign 0.00
R8335:Vsig10 UTSW 5 117348370 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCAGTGTAACAGTGTTCGGTG -3'
(R):5'- AAGGCTCTTAACCTTTGGGGCCAC -3'

Sequencing Primer
(F):5'- ctttccttgtgcctcagtttc -3'
(R):5'- TTTGGGGCCACCCAGAG -3'
Posted On2014-08-18