Incidental Mutation 'R0674:Olfr65'
ID 218580
Institutional Source Beutler Lab
Gene Symbol Olfr65
Ensembl Gene ENSMUSG00000110259
Gene Name olfactory receptor 65
Synonyms 5'[b]3, GA_x6K02T2PBJ9-6634906-6633983, MOR1-2
MMRRC Submission 038859-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R0674 (G1)
Quality Score 23
Status Validated
Chromosome 7
Chromosomal Location 103903487-103908650 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103907255 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 272 (V272A)
Ref Sequence ENSEMBL: ENSMUSP00000147914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106864] [ENSMUST00000209528] [ENSMUST00000214300]
AlphaFold A0A1B0GSF4
Predicted Effect probably benign
Transcript: ENSMUST00000106864
AA Change: V269A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102477
Gene: ENSMUSG00000110259
AA Change: V269A

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 2.1e-113 PFAM
Pfam:7TM_GPCR_Srsx 36 300 5.6e-7 PFAM
Pfam:7tm_1 42 293 5.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209528
AA Change: V272A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000214300
AA Change: V269A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0812 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 90.4%
Validation Efficiency 97% (124/128)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 37,044,626 V1134E possibly damaging Het
Adar A G 3: 89,749,823 probably benign Het
Adgrl2 A T 3: 148,837,679 M803K possibly damaging Het
Atp13a5 T C 16: 29,248,350 probably benign Het
Atp2a3 T C 11: 72,981,885 I753T probably damaging Het
Bace2 G A 16: 97,436,749 V467M possibly damaging Het
Ccser2 A G 14: 36,918,591 C11R possibly damaging Het
Cd2ap T A 17: 42,845,392 I85F possibly damaging Het
Cd2bp2 C T 7: 127,194,836 E94K probably damaging Het
Chrna3 C A 9: 55,015,172 A451S probably damaging Het
Cmya5 C A 13: 93,092,791 V1930F probably damaging Het
Csmd1 T C 8: 16,000,550 T2229A probably benign Het
Csrnp2 A T 15: 100,487,991 L122H probably damaging Het
Cyp11b2 G A 15: 74,855,544 P96L probably damaging Het
Ddr1 G T 17: 35,689,669 S368* probably null Het
E2f1 T C 2: 154,564,109 K115E probably damaging Het
Erlec1 A T 11: 30,935,073 probably benign Het
Fus T A 7: 127,972,776 probably benign Het
Gml G A 15: 74,813,860 T92I probably damaging Het
Herc1 T C 9: 66,501,192 S4567P probably damaging Het
Iglc2 A G 16: 19,198,841 S5P probably benign Het
Itgam T C 7: 128,116,218 V1028A possibly damaging Het
Krt222 T A 11: 99,236,260 N178I probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Luzp1 C T 4: 136,543,457 T997I possibly damaging Het
Maml1 G T 11: 50,258,058 Q952K probably benign Het
Map2 A G 1: 66,413,202 E499G probably damaging Het
Map4k4 A T 1: 40,003,815 H118L probably damaging Het
Myzap T C 9: 71,515,144 D382G probably damaging Het
Naip5 T C 13: 100,223,199 T510A probably benign Het
Nek6 G C 2: 38,558,904 G95R possibly damaging Het
Nphp3 T C 9: 104,036,282 probably null Het
Nr1d2 T C 14: 18,215,086 S309G probably benign Het
Nrcam A T 12: 44,564,322 I570F probably benign Het
Oas1d T C 5: 120,919,986 I331T probably benign Het
Olfr1306 A T 2: 111,912,673 F86I probably benign Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pex5l A T 3: 32,952,616 W535R probably damaging Het
Pisd C T 5: 32,774,437 R202H probably benign Het
Plxna2 A G 1: 194,649,475 N403S probably benign Het
Prdm12 A G 2: 31,643,912 I180M probably benign Het
Prpf6 A G 2: 181,631,974 T304A probably benign Het
Ptprm G A 17: 67,191,341 T35I possibly damaging Het
Ptx3 T A 3: 66,224,727 I223N probably damaging Het
Pygb G A 2: 150,815,134 probably null Het
Qrsl1 A G 10: 43,896,001 probably benign Het
Rad51ap2 T C 12: 11,458,817 probably null Het
Ralbp1 C T 17: 65,852,753 R505H probably benign Het
Rimbp3 T C 16: 17,212,737 S1342P probably benign Het
Slc22a14 C A 9: 119,178,542 R267L probably damaging Het
Slco6c1 T A 1: 97,104,773 probably benign Het
Tcp1 T C 17: 12,923,244 I375T probably damaging Het
Tiparp T C 3: 65,553,165 I525T probably benign Het
Tjp2 A G 19: 24,131,316 L144P probably benign Het
Tssk2 A G 16: 17,899,066 D111G probably benign Het
Ttn T C 2: 76,945,479 T1740A possibly damaging Het
Vmn2r102 T A 17: 19,677,867 D381E probably benign Het
Vsig10 C T 5: 117,343,846 T367M probably damaging Het
Wnt11 T C 7: 98,846,528 C80R probably damaging Het
Zar1 T A 5: 72,580,300 probably null Het
Zfp52 A T 17: 21,561,846 H652L probably damaging Het
Zpr1 T A 9: 46,275,449 L194Q probably damaging Het
Other mutations in Olfr65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01079:Olfr65 APN 7 103906462 missense probably benign
IGL02830:Olfr65 APN 7 103906444 missense probably benign 0.32
IGL03238:Olfr65 APN 7 103906510 missense probably benign
R1711:Olfr65 UTSW 7 103906699 missense probably damaging 1.00
R2018:Olfr65 UTSW 7 103907042 missense possibly damaging 0.88
R2363:Olfr65 UTSW 7 103907060 missense probably benign 0.19
R2968:Olfr65 UTSW 7 103907312 missense probably benign 0.01
R2970:Olfr65 UTSW 7 103907312 missense probably benign 0.01
R3746:Olfr65 UTSW 7 103907060 missense probably benign 0.19
R4928:Olfr65 UTSW 7 103906672 missense probably damaging 1.00
R5092:Olfr65 UTSW 7 103907199 nonsense probably null
R5635:Olfr65 UTSW 7 103906638 missense probably benign 0.05
R5881:Olfr65 UTSW 7 103906676 missense probably damaging 0.98
R5963:Olfr65 UTSW 7 103906961 missense probably benign 0.02
R5969:Olfr65 UTSW 7 103906910 missense probably damaging 0.98
R6859:Olfr65 UTSW 7 103906701 nonsense probably null
R7857:Olfr65 UTSW 7 103906610 missense
R8065:Olfr65 UTSW 7 103906403 start gained probably benign
R8067:Olfr65 UTSW 7 103906403 start gained probably benign
R8381:Olfr65 UTSW 7 103906939 missense
R8501:Olfr65 UTSW 7 103906611 missense
R8737:Olfr65 UTSW 7 103906706 missense
R8796:Olfr65 UTSW 7 103906994 missense
R9007:Olfr65 UTSW 7 103906958 missense
R9455:Olfr65 UTSW 7 103906993 missense
R9591:Olfr65 UTSW 7 103907263 missense
X0065:Olfr65 UTSW 7 103907216 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCGCTGACATCACATTCAATCG -3'
(R):5'- GCATGGGTACTTCTTCCTGCAACAC -3'

Sequencing Primer
(F):5'- GCAATGGTCTTGCTAGATTTCC -3'
(R):5'- CACTGTCACTATATTTACATTCCAGG -3'
Posted On 2014-08-18