Incidental Mutation 'R0674:Erlec1'
ID218586
Institutional Source Beutler Lab
Gene Symbol Erlec1
Ensembl Gene ENSMUSG00000020311
Gene Nameendoplasmic reticulum lectin 1
Synonyms4933407N01Rik
MMRRC Submission 038859-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0674 (G1)
Quality Score39
Status Validated
Chromosome11
Chromosomal Location30930774-30954335 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 30935073 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073192] [ENSMUST00000129593] [ENSMUST00000203878]
Predicted Effect probably benign
Transcript: ENSMUST00000073192
SMART Domains Protein: ENSMUSP00000072929
Gene: ENSMUSG00000020311

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:PRKCSH 111 199 6.6e-21 PFAM
Pfam:PRKCSH 342 421 2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129593
SMART Domains Protein: ENSMUSP00000129078
Gene: ENSMUSG00000020311

DomainStartEndE-ValueType
SCOP:d1c39a_ 2 52 1e-3 SMART
Pfam:PRKCSH 149 225 1.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143126
SMART Domains Protein: ENSMUSP00000126490
Gene: ENSMUSG00000020311

DomainStartEndE-ValueType
Pfam:PRKCSH 52 80 2.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203878
SMART Domains Protein: ENSMUSP00000144900
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
ANK 48 77 3.5e-2 SMART
ANK 81 110 8e-3 SMART
ANK 117 146 4.8e-5 SMART
ANK 150 179 1.7e-7 SMART
ANK 184 213 1.8e-4 SMART
ANK 217 246 1.8e-6 SMART
ANK 250 279 1.2e-7 SMART
ANK 285 315 1.1e0 SMART
ANK 318 347 1.2e-3 SMART
ANK 354 385 7.7e-1 SMART
SOCS 493 542 2.8e-4 SMART
SOCS_box 499 541 1.6e-17 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 90.4%
Validation Efficiency 97% (124/128)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a resident endoplasmic reticulum (ER) protein that functions in N-glycan recognition. This protein is thought to be involved in ER-associated degradation via its interaction with the membrane-associated ubiquitin ligase complex. It also functions as a regulator of multiple cellular stress-response pathways in a manner that promotes metastatic cell survival. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 21. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 37,044,626 V1134E possibly damaging Het
Adar A G 3: 89,749,823 probably benign Het
Adgrl2 A T 3: 148,837,679 M803K possibly damaging Het
Atp13a5 T C 16: 29,248,350 probably benign Het
Atp2a3 T C 11: 72,981,885 I753T probably damaging Het
Bace2 G A 16: 97,436,749 V467M possibly damaging Het
Ccser2 A G 14: 36,918,591 C11R possibly damaging Het
Cd2ap T A 17: 42,845,392 I85F possibly damaging Het
Cd2bp2 C T 7: 127,194,836 E94K probably damaging Het
Chrna3 C A 9: 55,015,172 A451S probably damaging Het
Cmya5 C A 13: 93,092,791 V1930F probably damaging Het
Csmd1 T C 8: 16,000,550 T2229A probably benign Het
Csrnp2 A T 15: 100,487,991 L122H probably damaging Het
Cyp11b2 G A 15: 74,855,544 P96L probably damaging Het
Ddr1 G T 17: 35,689,669 S368* probably null Het
E2f1 T C 2: 154,564,109 K115E probably damaging Het
Fus T A 7: 127,972,776 probably benign Het
Gml G A 15: 74,813,860 T92I probably damaging Het
Herc1 T C 9: 66,501,192 S4567P probably damaging Het
Iglc2 A G 16: 19,198,841 S5P probably benign Het
Itgam T C 7: 128,116,218 V1028A possibly damaging Het
Krt222 T A 11: 99,236,260 N178I probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Luzp1 C T 4: 136,543,457 T997I possibly damaging Het
Maml1 G T 11: 50,258,058 Q952K probably benign Het
Map2 A G 1: 66,413,202 E499G probably damaging Het
Map4k4 A T 1: 40,003,815 H118L probably damaging Het
Myzap T C 9: 71,515,144 D382G probably damaging Het
Naip5 T C 13: 100,223,199 T510A probably benign Het
Nek6 G C 2: 38,558,904 G95R possibly damaging Het
Nphp3 T C 9: 104,036,282 probably null Het
Nr1d2 T C 14: 18,215,086 S309G probably benign Het
Nrcam A T 12: 44,564,322 I570F probably benign Het
Oas1d T C 5: 120,919,986 I331T probably benign Het
Olfr1306 A T 2: 111,912,673 F86I probably benign Het
Olfr65 T C 7: 103,907,255 V272A probably benign Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pex5l A T 3: 32,952,616 W535R probably damaging Het
Pisd C T 5: 32,774,437 R202H probably benign Het
Plxna2 A G 1: 194,649,475 N403S probably benign Het
Prdm12 A G 2: 31,643,912 I180M probably benign Het
Prpf6 A G 2: 181,631,974 T304A probably benign Het
Ptprm G A 17: 67,191,341 T35I possibly damaging Het
Ptx3 T A 3: 66,224,727 I223N probably damaging Het
Pygb G A 2: 150,815,134 probably null Het
Qrsl1 A G 10: 43,896,001 probably benign Het
Rad51ap2 T C 12: 11,458,817 probably null Het
Ralbp1 C T 17: 65,852,753 R505H probably benign Het
Rimbp3 T C 16: 17,212,737 S1342P probably benign Het
Slc22a14 C A 9: 119,178,542 R267L probably damaging Het
Slco6c1 T A 1: 97,104,773 probably benign Het
Tcp1 T C 17: 12,923,244 I375T probably damaging Het
Tiparp T C 3: 65,553,165 I525T probably benign Het
Tjp2 A G 19: 24,131,316 L144P probably benign Het
Tssk2 A G 16: 17,899,066 D111G probably benign Het
Ttn T C 2: 76,945,479 T1740A possibly damaging Het
Vmn2r102 T A 17: 19,677,867 D381E probably benign Het
Vsig10 C T 5: 117,343,846 T367M probably damaging Het
Wnt11 T C 7: 98,846,528 C80R probably damaging Het
Zar1 T A 5: 72,580,300 probably null Het
Zfp52 A T 17: 21,561,846 H652L probably damaging Het
Zpr1 T A 9: 46,275,449 L194Q probably damaging Het
Other mutations in Erlec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Erlec1 APN 11 30948510 missense possibly damaging 0.84
IGL00537:Erlec1 APN 11 30939591 missense probably benign 0.04
IGL00766:Erlec1 APN 11 30950623 nonsense probably null
IGL01760:Erlec1 APN 11 30934731 missense probably benign 0.34
IGL02505:Erlec1 APN 11 30950767 missense probably damaging 1.00
IGL02633:Erlec1 APN 11 30948430 nonsense probably null
R1211:Erlec1 UTSW 11 30948298 critical splice donor site probably null
R1974:Erlec1 UTSW 11 30939604 missense possibly damaging 0.83
R4326:Erlec1 UTSW 11 30949972 missense probably benign
R4328:Erlec1 UTSW 11 30949972 missense probably benign
R4392:Erlec1 UTSW 11 30943697 critical splice donor site probably null
R4641:Erlec1 UTSW 11 30948442 nonsense probably null
R4697:Erlec1 UTSW 11 30952640 missense probably benign 0.27
R4917:Erlec1 UTSW 11 30934710 missense possibly damaging 0.56
R5486:Erlec1 UTSW 11 30935047 missense probably damaging 0.98
R5735:Erlec1 UTSW 11 30950591 missense probably benign 0.00
R5775:Erlec1 UTSW 11 30943848 missense probably benign 0.11
R6475:Erlec1 UTSW 11 30948442 nonsense probably null
R7027:Erlec1 UTSW 11 30950790 missense probably damaging 1.00
R7235:Erlec1 UTSW 11 30950751 missense possibly damaging 0.91
R7440:Erlec1 UTSW 11 30950818 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CCCCAAGAATATACTGGCACGAGTG -3'
(R):5'- GCTCACAGAAATCCTAAGGGCTGC -3'

Sequencing Primer
(F):5'- CACGAGTGAGGCTCTAGCATATAC -3'
(R):5'- ATCCTAAGGGCTGCTATTAGAAG -3'
Posted On2014-08-18