Incidental Mutation 'R0674:Atp2a3'
ID218588
Institutional Source Beutler Lab
Gene Symbol Atp2a3
Ensembl Gene ENSMUSG00000020788
Gene NameATPase, Ca++ transporting, ubiquitous
SynonymsSerca3
MMRRC Submission 038859-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R0674 (G1)
Quality Score54
Status Validated
Chromosome11
Chromosomal Location72961169-72993044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72981885 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 753 (I753T)
Ref Sequence ENSEMBL: ENSMUSP00000127036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021142] [ENSMUST00000108484] [ENSMUST00000108485] [ENSMUST00000108486] [ENSMUST00000163326]
Predicted Effect probably damaging
Transcript: ENSMUST00000021142
AA Change: I753T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021142
Gene: ENSMUSG00000020788
AA Change: I753T

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 92 340 3.1e-66 PFAM
Pfam:Hydrolase 345 715 5.2e-22 PFAM
Pfam:HAD 348 712 3e-19 PFAM
Pfam:Cation_ATPase 418 528 4.4e-23 PFAM
Pfam:Hydrolase_3 684 747 4.5e-8 PFAM
Pfam:Cation_ATPase_C 784 987 1.8e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108484
AA Change: I735T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104124
Gene: ENSMUSG00000020788
AA Change: I735T

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 3.4e-16 SMART
Pfam:E1-E2_ATPase 93 341 8.9e-67 PFAM
Pfam:Hydrolase 345 697 8.1e-27 PFAM
Pfam:HAD 348 694 4.1e-14 PFAM
Pfam:Hydrolase_like2 418 528 2.1e-21 PFAM
Pfam:Hydrolase_3 666 729 2.6e-6 PFAM
transmembrane domain 742 764 N/A INTRINSIC
Pfam:Cation_ATPase_C 766 969 4.2e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108485
AA Change: I753T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104125
Gene: ENSMUSG00000020788
AA Change: I753T

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 93 341 1.1e-68 PFAM
Pfam:Hydrolase 345 715 2.7e-33 PFAM
Pfam:HAD 348 712 1.3e-17 PFAM
Pfam:Hydrolase_like2 418 528 2.2e-23 PFAM
Pfam:Hydrolase_3 684 747 1.8e-8 PFAM
Pfam:Cation_ATPase_C 784 987 2.6e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108486
AA Change: I735T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104126
Gene: ENSMUSG00000020788
AA Change: I735T

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 93 341 1.4e-68 PFAM
Pfam:Hydrolase 345 697 2.8e-28 PFAM
Pfam:HAD 348 694 1.1e-15 PFAM
Pfam:Hydrolase_like2 418 528 1.7e-23 PFAM
Pfam:Hydrolase_3 666 729 5.1e-8 PFAM
Pfam:Cation_ATPase_C 766 969 2.5e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135234
Predicted Effect probably damaging
Transcript: ENSMUST00000163326
AA Change: I753T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127036
Gene: ENSMUSG00000020788
AA Change: I753T

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 93 341 1.4e-68 PFAM
Pfam:Hydrolase 345 715 6.5e-33 PFAM
Pfam:HAD 348 712 2.5e-17 PFAM
Pfam:Hydrolase_like2 418 528 1.7e-23 PFAM
Pfam:Hydrolase_3 684 747 5.1e-8 PFAM
Pfam:Cation_ATPase_C 784 987 2.5e-48 PFAM
Meta Mutation Damage Score 0.9050 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 90.4%
Validation Efficiency 97% (124/128)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the sarcoplasmic reticulum lumen, and is involved in calcium sequestration associated with muscular excitation and contraction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced endothelial-dependent relaxation in the aorta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 37,044,626 V1134E possibly damaging Het
Adar A G 3: 89,749,823 probably benign Het
Adgrl2 A T 3: 148,837,679 M803K possibly damaging Het
Atp13a5 T C 16: 29,248,350 probably benign Het
Bace2 G A 16: 97,436,749 V467M possibly damaging Het
Ccser2 A G 14: 36,918,591 C11R possibly damaging Het
Cd2ap T A 17: 42,845,392 I85F possibly damaging Het
Cd2bp2 C T 7: 127,194,836 E94K probably damaging Het
Chrna3 C A 9: 55,015,172 A451S probably damaging Het
Cmya5 C A 13: 93,092,791 V1930F probably damaging Het
Csmd1 T C 8: 16,000,550 T2229A probably benign Het
Csrnp2 A T 15: 100,487,991 L122H probably damaging Het
Cyp11b2 G A 15: 74,855,544 P96L probably damaging Het
Ddr1 G T 17: 35,689,669 S368* probably null Het
E2f1 T C 2: 154,564,109 K115E probably damaging Het
Erlec1 A T 11: 30,935,073 probably benign Het
Fus T A 7: 127,972,776 probably benign Het
Gml G A 15: 74,813,860 T92I probably damaging Het
Herc1 T C 9: 66,501,192 S4567P probably damaging Het
Iglc2 A G 16: 19,198,841 S5P probably benign Het
Itgam T C 7: 128,116,218 V1028A possibly damaging Het
Krt222 T A 11: 99,236,260 N178I probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Luzp1 C T 4: 136,543,457 T997I possibly damaging Het
Maml1 G T 11: 50,258,058 Q952K probably benign Het
Map2 A G 1: 66,413,202 E499G probably damaging Het
Map4k4 A T 1: 40,003,815 H118L probably damaging Het
Myzap T C 9: 71,515,144 D382G probably damaging Het
Naip5 T C 13: 100,223,199 T510A probably benign Het
Nek6 G C 2: 38,558,904 G95R possibly damaging Het
Nphp3 T C 9: 104,036,282 probably null Het
Nr1d2 T C 14: 18,215,086 S309G probably benign Het
Nrcam A T 12: 44,564,322 I570F probably benign Het
Oas1d T C 5: 120,919,986 I331T probably benign Het
Olfr1306 A T 2: 111,912,673 F86I probably benign Het
Olfr65 T C 7: 103,907,255 V272A probably benign Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pex5l A T 3: 32,952,616 W535R probably damaging Het
Pisd C T 5: 32,774,437 R202H probably benign Het
Plxna2 A G 1: 194,649,475 N403S probably benign Het
Prdm12 A G 2: 31,643,912 I180M probably benign Het
Prpf6 A G 2: 181,631,974 T304A probably benign Het
Ptprm G A 17: 67,191,341 T35I possibly damaging Het
Ptx3 T A 3: 66,224,727 I223N probably damaging Het
Pygb G A 2: 150,815,134 probably null Het
Qrsl1 A G 10: 43,896,001 probably benign Het
Rad51ap2 T C 12: 11,458,817 probably null Het
Ralbp1 C T 17: 65,852,753 R505H probably benign Het
Rimbp3 T C 16: 17,212,737 S1342P probably benign Het
Slc22a14 C A 9: 119,178,542 R267L probably damaging Het
Slco6c1 T A 1: 97,104,773 probably benign Het
Tcp1 T C 17: 12,923,244 I375T probably damaging Het
Tiparp T C 3: 65,553,165 I525T probably benign Het
Tjp2 A G 19: 24,131,316 L144P probably benign Het
Tssk2 A G 16: 17,899,066 D111G probably benign Het
Ttn T C 2: 76,945,479 T1740A possibly damaging Het
Vmn2r102 T A 17: 19,677,867 D381E probably benign Het
Vsig10 C T 5: 117,343,846 T367M probably damaging Het
Wnt11 T C 7: 98,846,528 C80R probably damaging Het
Zar1 T A 5: 72,580,300 probably null Het
Zfp52 A T 17: 21,561,846 H652L probably damaging Het
Zpr1 T A 9: 46,275,449 L194Q probably damaging Het
Other mutations in Atp2a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Atp2a3 APN 11 72982787 missense probably damaging 0.98
IGL01141:Atp2a3 APN 11 72982665 missense probably damaging 1.00
IGL01949:Atp2a3 APN 11 72981897 missense probably damaging 1.00
IGL02267:Atp2a3 APN 11 72987984 missense probably damaging 1.00
IGL02385:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02390:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02391:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02392:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02487:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02525:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02526:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02527:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02581:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02643:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02644:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02646:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02647:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02649:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02650:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02651:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02667:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02668:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02819:Atp2a3 APN 11 72977207 missense probably damaging 1.00
IGL02888:Atp2a3 APN 11 72977128 splice site probably benign
R0193:Atp2a3 UTSW 11 72972220 missense possibly damaging 0.57
R0357:Atp2a3 UTSW 11 72970931 critical splice donor site probably null
R0376:Atp2a3 UTSW 11 72982702 missense probably damaging 1.00
R0452:Atp2a3 UTSW 11 72977232 splice site probably null
R0494:Atp2a3 UTSW 11 72981905 missense probably damaging 1.00
R0588:Atp2a3 UTSW 11 72973024 missense possibly damaging 0.79
R1586:Atp2a3 UTSW 11 72991744 missense probably damaging 0.98
R1666:Atp2a3 UTSW 11 72978807 critical splice donor site probably null
R1994:Atp2a3 UTSW 11 72975414 missense probably damaging 0.99
R2087:Atp2a3 UTSW 11 72980448 missense probably damaging 1.00
R4675:Atp2a3 UTSW 11 72981797 missense probably damaging 1.00
R4795:Atp2a3 UTSW 11 72973029 missense probably benign 0.01
R4898:Atp2a3 UTSW 11 72982680 missense probably damaging 1.00
R5083:Atp2a3 UTSW 11 72982826 missense probably null 0.49
R5174:Atp2a3 UTSW 11 72980215 missense probably damaging 1.00
R5266:Atp2a3 UTSW 11 72975397 missense probably damaging 1.00
R5304:Atp2a3 UTSW 11 72988557 missense probably damaging 0.98
R5802:Atp2a3 UTSW 11 72972882 missense probably damaging 1.00
R6107:Atp2a3 UTSW 11 72988461 critical splice acceptor site probably null
R6157:Atp2a3 UTSW 11 72980616 missense probably damaging 1.00
R6760:Atp2a3 UTSW 11 72982740 missense probably damaging 1.00
R7406:Atp2a3 UTSW 11 72978750 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGACGTAGGCAAGTCTCTCAG -3'
(R):5'- TCTCCAGTCTTATGGGTCTCAACGG -3'

Sequencing Primer
(F):5'- GCAAGTCTCTCAGGTGTGTCC -3'
(R):5'- ACAACCTCGCCAACATTGG -3'
Posted On2014-08-18