Incidental Mutation 'R0674:Naip5'
ID218589
Institutional Source Beutler Lab
Gene Symbol Naip5
Ensembl Gene ENSMUSG00000071203
Gene NameNLR family, apoptosis inhibitory protein 5
SynonymsBirc1e, Lgn1, Naip-rs3
MMRRC Submission 038859-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R0674 (G1)
Quality Score42
Status Validated
Chromosome13
Chromosomal Location100211739-100246323 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100223199 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 510 (T510A)
Ref Sequence ENSEMBL: ENSMUSP00000058611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049789]
Predicted Effect probably benign
Transcript: ENSMUST00000049789
AA Change: T510A

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000058611
Gene: ENSMUSG00000071203
AA Change: T510A

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.08e-19 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 2.14e-32 SMART
Pfam:NACHT 464 618 1.7e-36 PFAM
low complexity region 851 862 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 90.4%
Validation Efficiency 97% (124/128)
MGI Phenotype PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 37,044,626 V1134E possibly damaging Het
Adar A G 3: 89,749,823 probably benign Het
Adgrl2 A T 3: 148,837,679 M803K possibly damaging Het
Atp13a5 T C 16: 29,248,350 probably benign Het
Atp2a3 T C 11: 72,981,885 I753T probably damaging Het
Bace2 G A 16: 97,436,749 V467M possibly damaging Het
Ccser2 A G 14: 36,918,591 C11R possibly damaging Het
Cd2ap T A 17: 42,845,392 I85F possibly damaging Het
Cd2bp2 C T 7: 127,194,836 E94K probably damaging Het
Chrna3 C A 9: 55,015,172 A451S probably damaging Het
Cmya5 C A 13: 93,092,791 V1930F probably damaging Het
Csmd1 T C 8: 16,000,550 T2229A probably benign Het
Csrnp2 A T 15: 100,487,991 L122H probably damaging Het
Cyp11b2 G A 15: 74,855,544 P96L probably damaging Het
Ddr1 G T 17: 35,689,669 S368* probably null Het
E2f1 T C 2: 154,564,109 K115E probably damaging Het
Erlec1 A T 11: 30,935,073 probably benign Het
Fus T A 7: 127,972,776 probably benign Het
Gml G A 15: 74,813,860 T92I probably damaging Het
Herc1 T C 9: 66,501,192 S4567P probably damaging Het
Iglc2 A G 16: 19,198,841 S5P probably benign Het
Itgam T C 7: 128,116,218 V1028A possibly damaging Het
Krt222 T A 11: 99,236,260 N178I probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Luzp1 C T 4: 136,543,457 T997I possibly damaging Het
Maml1 G T 11: 50,258,058 Q952K probably benign Het
Map2 A G 1: 66,413,202 E499G probably damaging Het
Map4k4 A T 1: 40,003,815 H118L probably damaging Het
Myzap T C 9: 71,515,144 D382G probably damaging Het
Nek6 G C 2: 38,558,904 G95R possibly damaging Het
Nphp3 T C 9: 104,036,282 probably null Het
Nr1d2 T C 14: 18,215,086 S309G probably benign Het
Nrcam A T 12: 44,564,322 I570F probably benign Het
Oas1d T C 5: 120,919,986 I331T probably benign Het
Olfr1306 A T 2: 111,912,673 F86I probably benign Het
Olfr65 T C 7: 103,907,255 V272A probably benign Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pex5l A T 3: 32,952,616 W535R probably damaging Het
Pisd C T 5: 32,774,437 R202H probably benign Het
Plxna2 A G 1: 194,649,475 N403S probably benign Het
Prdm12 A G 2: 31,643,912 I180M probably benign Het
Prpf6 A G 2: 181,631,974 T304A probably benign Het
Ptprm G A 17: 67,191,341 T35I possibly damaging Het
Ptx3 T A 3: 66,224,727 I223N probably damaging Het
Pygb G A 2: 150,815,134 probably null Het
Qrsl1 A G 10: 43,896,001 probably benign Het
Rad51ap2 T C 12: 11,458,817 probably null Het
Ralbp1 C T 17: 65,852,753 R505H probably benign Het
Rimbp3 T C 16: 17,212,737 S1342P probably benign Het
Slc22a14 C A 9: 119,178,542 R267L probably damaging Het
Slco6c1 T A 1: 97,104,773 probably benign Het
Tcp1 T C 17: 12,923,244 I375T probably damaging Het
Tiparp T C 3: 65,553,165 I525T probably benign Het
Tjp2 A G 19: 24,131,316 L144P probably benign Het
Tssk2 A G 16: 17,899,066 D111G probably benign Het
Ttn T C 2: 76,945,479 T1740A possibly damaging Het
Vmn2r102 T A 17: 19,677,867 D381E probably benign Het
Vsig10 C T 5: 117,343,846 T367M probably damaging Het
Wnt11 T C 7: 98,846,528 C80R probably damaging Het
Zar1 T A 5: 72,580,300 probably null Het
Zfp52 A T 17: 21,561,846 H652L probably damaging Het
Zpr1 T A 9: 46,275,449 L194Q probably damaging Het
Other mutations in Naip5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Naip5 APN 13 100246175 nonsense probably null
IGL00493:Naip5 APN 13 100230771 missense probably damaging 0.96
IGL01294:Naip5 APN 13 100217080 missense probably damaging 0.99
IGL01405:Naip5 APN 13 100221945 missense probably benign 0.11
IGL01568:Naip5 APN 13 100217101 missense probably benign 0.26
IGL01804:Naip5 APN 13 100221584 missense probably damaging 1.00
IGL02012:Naip5 APN 13 100223339 missense probably benign 0.01
IGL02183:Naip5 APN 13 100221642 missense probably benign 0.41
IGL02449:Naip5 APN 13 100222175 missense probably benign 0.34
IGL02815:Naip5 APN 13 100222731 missense probably benign
IGL02992:Naip5 APN 13 100223028 missense probably damaging 1.00
IGL03027:Naip5 APN 13 100223016 missense probably benign 0.00
IGL03234:Naip5 APN 13 100212627 missense probably damaging 1.00
inwood2 UTSW 13 100223014 nonsense probably null
inwood3 UTSW 13 100221903 nonsense probably null
PIT4131001:Naip5 UTSW 13 100219739 missense probably benign
PIT4131001:Naip5 UTSW 13 100219760 missense probably benign 0.00
R0001:Naip5 UTSW 13 100214650 critical splice donor site probably null
R0001:Naip5 UTSW 13 100223114 missense probably benign
R0462:Naip5 UTSW 13 100221732 missense probably damaging 1.00
R0636:Naip5 UTSW 13 100219688 missense probably benign
R0764:Naip5 UTSW 13 100217105 missense probably benign 0.03
R0837:Naip5 UTSW 13 100230743 missense probably benign
R1179:Naip5 UTSW 13 100219830 missense probably benign
R1302:Naip5 UTSW 13 100221591 missense possibly damaging 0.91
R1441:Naip5 UTSW 13 100219717 missense possibly damaging 0.95
R1513:Naip5 UTSW 13 100222206 missense probably benign
R1638:Naip5 UTSW 13 100212669 missense probably damaging 1.00
R1651:Naip5 UTSW 13 100221911 missense probably benign 0.41
R1707:Naip5 UTSW 13 100242855 missense probably damaging 1.00
R1835:Naip5 UTSW 13 100223218 nonsense probably null
R1836:Naip5 UTSW 13 100219687 missense probably benign 0.18
R1972:Naip5 UTSW 13 100212770 missense probably damaging 0.98
R2080:Naip5 UTSW 13 100221533 missense probably damaging 1.00
R2333:Naip5 UTSW 13 100223171 missense probably damaging 1.00
R2348:Naip5 UTSW 13 100219738 missense probably benign 0.01
R3055:Naip5 UTSW 13 100221878 missense probably benign 0.23
R3401:Naip5 UTSW 13 100221903 nonsense probably null
R3723:Naip5 UTSW 13 100223014 nonsense probably null
R3775:Naip5 UTSW 13 100223375 missense probably benign 0.00
R3775:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4074:Naip5 UTSW 13 100246064 missense probably damaging 1.00
R4082:Naip5 UTSW 13 100245830 missense probably damaging 1.00
R4105:Naip5 UTSW 13 100219739 missense probably benign
R4227:Naip5 UTSW 13 100212768 missense probably damaging 0.99
R4639:Naip5 UTSW 13 100219830 missense probably benign
R4640:Naip5 UTSW 13 100219830 missense probably benign
R4641:Naip5 UTSW 13 100219830 missense probably benign
R4644:Naip5 UTSW 13 100219830 missense probably benign
R4645:Naip5 UTSW 13 100219830 missense probably benign
R4700:Naip5 UTSW 13 100223414 missense possibly damaging 0.62
R4727:Naip5 UTSW 13 100221870 missense possibly damaging 0.81
R4729:Naip5 UTSW 13 100222131 missense possibly damaging 0.75
R4816:Naip5 UTSW 13 100219681 missense probably benign 0.32
R4816:Naip5 UTSW 13 100219687 missense probably benign 0.01
R4816:Naip5 UTSW 13 100219696 missense probably benign 0.00
R4869:Naip5 UTSW 13 100245131 missense probably damaging 1.00
R5162:Naip5 UTSW 13 100223406 missense possibly damaging 0.78
R5244:Naip5 UTSW 13 100245662 missense probably benign 0.08
R5411:Naip5 UTSW 13 100245746 missense possibly damaging 0.54
R5632:Naip5 UTSW 13 100230662 splice site probably null
R5760:Naip5 UTSW 13 100242838 missense probably damaging 1.00
R5916:Naip5 UTSW 13 100222701 missense probably benign 0.02
R6302:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6304:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6411:Naip5 UTSW 13 100223405 missense probably benign 0.01
R6474:Naip5 UTSW 13 100214663 missense possibly damaging 0.82
R6499:Naip5 UTSW 13 100221594 missense probably benign
R6544:Naip5 UTSW 13 100223144 missense possibly damaging 0.50
R6827:Naip5 UTSW 13 100245929 missense possibly damaging 0.48
R6954:Naip5 UTSW 13 100223414 missense probably damaging 0.99
R7052:Naip5 UTSW 13 100222347 missense probably benign 0.01
R7138:Naip5 UTSW 13 100219830 missense probably benign
R7141:Naip5 UTSW 13 100219830 missense probably benign
R7375:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7375:Naip5 UTSW 13 100219697 missense not run
R7401:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7401:Naip5 UTSW 13 100219697 missense not run
R7447:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7447:Naip5 UTSW 13 100219697 missense not run
R7466:Naip5 UTSW 13 100221986 nonsense probably null
R7491:Naip5 UTSW 13 100217071 missense probably benign 0.18
R7559:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7559:Naip5 UTSW 13 100219697 missense not run
R7562:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7562:Naip5 UTSW 13 100219697 missense not run
R7588:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7588:Naip5 UTSW 13 100219697 missense not run
R7589:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7589:Naip5 UTSW 13 100219697 missense not run
R7590:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7590:Naip5 UTSW 13 100219697 missense not run
Predicted Primers PCR Primer
(F):5'- GCACAGCGATCAATAAGCAGGTCC -3'
(R):5'- ACTTGCCAGAAGTGTGCTCCAG -3'

Sequencing Primer
(F):5'- TCAATAAGCAGGTCCGTGAC -3'
(R):5'- AGAAGTGTGCTCCAGCCTTG -3'
Posted On2014-08-18