Incidental Mutation 'R0674:Bace2'
ID 218596
Institutional Source Beutler Lab
Gene Symbol Bace2
Ensembl Gene ENSMUSG00000040605
Gene Name beta-site APP-cleaving enzyme 2
Synonyms ARP1, 1110059C24Rik, BAE2, ALP56, ASP21, CDA13, CEAP1
MMRRC Submission 038859-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R0674 (G1)
Quality Score 31
Status Validated
Chromosome 16
Chromosomal Location 97157942-97244136 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 97237949 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 467 (V467M)
Ref Sequence ENSEMBL: ENSMUSP00000043918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047275]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000047275
AA Change: V467M

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043918
Gene: ENSMUSG00000040605
AA Change: V467M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Asp 87 427 2.3e-47 PFAM
Pfam:TAXi_C 269 426 4.4e-16 PFAM
transmembrane domain 466 488 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231892
Meta Mutation Damage Score 0.1069 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 90.4%
Validation Efficiency 97% (124/128)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein undergoes proteolytic processing to generate an active endopeptidase enzyme. This transmembrane protease catalyzes the proteolysis of amyloid precursor protein to produce amyloid beta peptide. Mice lacking the encoded product exhibit increased pancreatic beta cell mass and improved glucose tolerance due to increased insulin secretion. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in impaired APP processing by neurons and glia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adar A G 3: 89,657,130 (GRCm39) probably benign Het
Adgrl2 A T 3: 148,543,315 (GRCm39) M803K possibly damaging Het
Atp13a5 T C 16: 29,067,102 (GRCm39) probably benign Het
Atp2a3 T C 11: 72,872,711 (GRCm39) I753T probably damaging Het
Bltp1 T A 3: 37,098,775 (GRCm39) V1134E possibly damaging Het
Ccser2 A G 14: 36,640,548 (GRCm39) C11R possibly damaging Het
Cd2ap T A 17: 43,156,283 (GRCm39) I85F possibly damaging Het
Cd2bp2 C T 7: 126,794,008 (GRCm39) E94K probably damaging Het
Chrna3 C A 9: 54,922,456 (GRCm39) A451S probably damaging Het
Cmya5 C A 13: 93,229,299 (GRCm39) V1930F probably damaging Het
Csmd1 T C 8: 16,050,550 (GRCm39) T2229A probably benign Het
Csrnp2 A T 15: 100,385,872 (GRCm39) L122H probably damaging Het
Cyp11b2 G A 15: 74,727,393 (GRCm39) P96L probably damaging Het
Ddr1 G T 17: 36,000,561 (GRCm39) S368* probably null Het
E2f1 T C 2: 154,406,029 (GRCm39) K115E probably damaging Het
Erlec1 A T 11: 30,885,073 (GRCm39) probably benign Het
Fus T A 7: 127,571,948 (GRCm39) probably benign Het
Gml G A 15: 74,685,709 (GRCm39) T92I probably damaging Het
Herc1 T C 9: 66,408,474 (GRCm39) S4567P probably damaging Het
Iglc2 A G 16: 19,017,591 (GRCm39) S5P probably benign Het
Itgam T C 7: 127,715,390 (GRCm39) V1028A possibly damaging Het
Krt222 T A 11: 99,127,086 (GRCm39) N178I probably benign Het
Krt81 C A 15: 101,361,508 (GRCm39) R24L possibly damaging Het
Luzp1 C T 4: 136,270,768 (GRCm39) T997I possibly damaging Het
Maml1 G T 11: 50,148,885 (GRCm39) Q952K probably benign Het
Map2 A G 1: 66,452,361 (GRCm39) E499G probably damaging Het
Map4k4 A T 1: 40,042,975 (GRCm39) H118L probably damaging Het
Myzap T C 9: 71,422,426 (GRCm39) D382G probably damaging Het
Naip5 T C 13: 100,359,707 (GRCm39) T510A probably benign Het
Nek6 G C 2: 38,448,916 (GRCm39) G95R possibly damaging Het
Nphp3 T C 9: 103,913,481 (GRCm39) probably null Het
Nr1d2 T C 14: 18,215,086 (GRCm38) S309G probably benign Het
Nrcam A T 12: 44,611,105 (GRCm39) I570F probably benign Het
Oas1d T C 5: 121,058,049 (GRCm39) I331T probably benign Het
Or2h2c G C 17: 37,422,347 (GRCm39) L176V probably benign Het
Or4f14 A T 2: 111,743,018 (GRCm39) F86I probably benign Het
Or51b6 T C 7: 103,556,462 (GRCm39) V272A probably benign Het
Pex5l A T 3: 33,006,765 (GRCm39) W535R probably damaging Het
Pisd C T 5: 32,931,781 (GRCm39) R202H probably benign Het
Plxna2 A G 1: 194,331,783 (GRCm39) N403S probably benign Het
Prdm12 A G 2: 31,533,924 (GRCm39) I180M probably benign Het
Prpf6 A G 2: 181,273,767 (GRCm39) T304A probably benign Het
Ptprm G A 17: 67,498,336 (GRCm39) T35I possibly damaging Het
Ptx3 T A 3: 66,132,148 (GRCm39) I223N probably damaging Het
Pygb G A 2: 150,657,054 (GRCm39) probably null Het
Qrsl1 A G 10: 43,771,997 (GRCm39) probably benign Het
Rad51ap2 T C 12: 11,508,818 (GRCm39) probably null Het
Ralbp1 C T 17: 66,159,748 (GRCm39) R505H probably benign Het
Rimbp3 T C 16: 17,030,601 (GRCm39) S1342P probably benign Het
Slc22a14 C A 9: 119,007,608 (GRCm39) R267L probably damaging Het
Slco6c1 T A 1: 97,032,498 (GRCm39) probably benign Het
Tcp1 T C 17: 13,142,131 (GRCm39) I375T probably damaging Het
Tiparp T C 3: 65,460,586 (GRCm39) I525T probably benign Het
Tjp2 A G 19: 24,108,680 (GRCm39) L144P probably benign Het
Tssk2 A G 16: 17,716,930 (GRCm39) D111G probably benign Het
Ttn T C 2: 76,775,823 (GRCm39) T1740A possibly damaging Het
Vmn2r102 T A 17: 19,898,129 (GRCm39) D381E probably benign Het
Vsig10 C T 5: 117,481,911 (GRCm39) T367M probably damaging Het
Wnt11 T C 7: 98,495,735 (GRCm39) C80R probably damaging Het
Zar1 T A 5: 72,737,643 (GRCm39) probably null Het
Zfp52 A T 17: 21,782,108 (GRCm39) H652L probably damaging Het
Zpr1 T A 9: 46,186,747 (GRCm39) L194Q probably damaging Het
Other mutations in Bace2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Bace2 APN 16 97,209,630 (GRCm39) missense probably damaging 0.97
IGL02660:Bace2 APN 16 97,216,340 (GRCm39) missense probably damaging 1.00
IGL02669:Bace2 APN 16 97,238,093 (GRCm39) makesense probably null
R0244:Bace2 UTSW 16 97,237,973 (GRCm39) splice site probably null
R0906:Bace2 UTSW 16 97,158,141 (GRCm39) missense possibly damaging 0.67
R1078:Bace2 UTSW 16 97,158,060 (GRCm39) missense unknown
R1670:Bace2 UTSW 16 97,213,335 (GRCm39) missense probably damaging 0.96
R1997:Bace2 UTSW 16 97,216,289 (GRCm39) missense possibly damaging 0.93
R2050:Bace2 UTSW 16 97,213,336 (GRCm39) missense probably damaging 1.00
R2937:Bace2 UTSW 16 97,213,388 (GRCm39) critical splice donor site probably null
R2938:Bace2 UTSW 16 97,213,388 (GRCm39) critical splice donor site probably null
R3103:Bace2 UTSW 16 97,223,201 (GRCm39) critical splice donor site probably null
R3755:Bace2 UTSW 16 97,237,857 (GRCm39) missense probably benign 0.34
R4110:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4112:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4113:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4560:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4562:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4563:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4717:Bace2 UTSW 16 97,238,073 (GRCm39) missense probably damaging 1.00
R5535:Bace2 UTSW 16 97,214,625 (GRCm39) missense probably damaging 1.00
R6282:Bace2 UTSW 16 97,216,297 (GRCm39) missense probably damaging 1.00
R6364:Bace2 UTSW 16 97,214,633 (GRCm39) missense probably benign 0.05
R7045:Bace2 UTSW 16 97,200,865 (GRCm39) missense probably damaging 1.00
R7241:Bace2 UTSW 16 97,237,998 (GRCm39) missense possibly damaging 0.92
R7546:Bace2 UTSW 16 97,200,882 (GRCm39) missense probably benign 0.01
R7653:Bace2 UTSW 16 97,237,852 (GRCm39) missense
R8026:Bace2 UTSW 16 97,238,052 (GRCm39) missense probably benign 0.26
R8171:Bace2 UTSW 16 97,225,786 (GRCm39) missense possibly damaging 0.86
R8324:Bace2 UTSW 16 97,158,108 (GRCm39) missense possibly damaging 0.51
R8341:Bace2 UTSW 16 97,158,108 (GRCm39) missense possibly damaging 0.51
R8480:Bace2 UTSW 16 97,214,670 (GRCm39) missense probably damaging 1.00
R9205:Bace2 UTSW 16 97,158,059 (GRCm39) missense unknown
R9221:Bace2 UTSW 16 97,209,692 (GRCm39) missense probably benign 0.01
X0024:Bace2 UTSW 16 97,214,598 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGTAAGGGCTTCTTGACTCAC -3'
(R):5'- AGTCTGGAAGGCATTCAGTTGCAC -3'

Sequencing Primer
(F):5'- TGTCTGAAATTTCTGGGCCC -3'
(R):5'- CAGTTGAGGTTCCCGACTAATAG -3'
Posted On 2014-08-18