Mutagenetix > Incidental Mutation

Incidental Mutation 'R0684:Sema3a'

218625

Institutional Source

Beutler Lab

Gene Symbol

Sema3a

Ensembl Gene

ENSMUSG00000028883

Gene Name

sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A

Synonyms

Semad, semaphorin III, SemD, sema III, collapsin-1

MMRRC Submission

038869-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R0684 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

13125414-13602565 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

G to A at 13556527 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000128153 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030714] [ENSMUST00000030714] [ENSMUST00000095012] [ENSMUST00000095012] [ENSMUST00000137798] [ENSMUST00000137798]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000030714

SMART Domains

Protein: ENSMUSP00000030714
Gene: ENSMUSG00000028883

Domain	Start	End	E-Value	Type
Sema	57	498	4.09e-219	SMART
PSI	516	568	3.03e-12	SMART
IG	583	669	3.54e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000030714

SMART Domains

Protein: ENSMUSP00000030714
Gene: ENSMUSG00000028883

Domain	Start	End	E-Value	Type
Sema	57	498	4.09e-219	SMART
PSI	516	568	3.03e-12	SMART
IG	583	669	3.54e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000095012

SMART Domains

Protein: ENSMUSP00000092621
Gene: ENSMUSG00000028883

Domain	Start	End	E-Value	Type
Sema	57	498	4.09e-219	SMART
PSI	516	568	3.03e-12	SMART
IG	583	669	3.54e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000095012

SMART Domains

Protein: ENSMUSP00000092621
Gene: ENSMUSG00000028883

Domain	Start	End	E-Value	Type
Sema	57	498	4.09e-219	SMART
PSI	516	568	3.03e-12	SMART
IG	583	669	3.54e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000137798

SMART Domains

Protein: ENSMUSP00000128153
Gene: ENSMUSG00000028883

Domain	Start	End	E-Value	Type
Sema	57	498	4.09e-219	SMART
PSI	516	568	3.03e-12	SMART
IG	583	669	3.54e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000137798

SMART Domains

Protein: ENSMUSP00000128153
Gene: ENSMUSG00000028883

Domain	Start	End	E-Value	Type
Sema	57	498	4.09e-219	SMART
PSI	516	568	3.03e-12	SMART
IG	583	669	3.54e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197552

Meta Mutation Damage Score

0.9492

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.1%
20x: 88.8%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the semaphorin family and encodes a protein with an Ig-like C2-type (immunoglobulin-like) domain, a PSI domain and a Sema domain. This secreted protein can function as either a chemorepulsive agent, inhibiting axonal outgrowth, or as a chemoattractive agent, stimulating the growth of apical dendrites. In both cases, the protein is vital for normal neuronal pattern development. Increased expression of this protein is associated with schizophrenia and is seen in a variety of human tumor cell lines. Also, aberrant release of this protein is associated with the progression of Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit patterning abnormalities of sensory and sympathetic neurons, abnormal embryonic bones and cartilaginous structures, cardiac defects, and high postnatal mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630095E13Rik	C	T	9: 36,637,880	G28E	probably benign	Het
Adam4	A	T	12: 81,419,654	L731H	probably damaging	Het
Adora2b	C	T	11: 62,249,169	A23V	probably benign	Het
Ankrd17	T	C	5: 90,263,998	I1336V	probably damaging	Het
Asxl1	G	A	2: 153,397,522	R410H	probably damaging	Het
Atp8a2	T	C	14: 60,023,144	E419G	probably benign	Het
Atxn1l	A	T	8: 109,732,384	N415K	probably damaging	Het
Bcl2l12	T	A	7: 44,996,601	T65S	probably benign	Het
Bdh2	A	G	3: 135,291,013	I90V	probably benign	Het
Bsph1	T	A	7: 13,473,063	N121K	probably damaging	Het
Cd96	T	C	16: 46,117,790	Y104C	possibly damaging	Het
Chdh	T	C	14: 30,031,613	W160R	probably damaging	Het
Clock	A	G	5: 76,245,518	F193L	probably damaging	Het
Copz1	A	G	15: 103,296,531		probably null	Het
Cyp2c38	T	C	19: 39,391,056	T450A	probably damaging	Het
Cyp2d34	A	T	15: 82,617,550	I253K	probably benign	Het
Dhrs13	G	T	11: 78,036,963	A212S	probably damaging	Het
Ecsit	T	C	9: 22,076,500	N81S	probably benign	Het
Efl1	A	G	7: 82,651,886	T33A	probably damaging	Het
Emid1	T	C	11: 5,143,866	R92G	probably damaging	Het
Ermp1	A	G	19: 29,632,541		probably benign	Het
Fn1	A	T	1: 71,595,809		probably null	Het
Hps5	A	G	7: 46,783,469		probably null	Het
Hsd17b3	T	C	13: 64,089,068	M21V	probably benign	Het
Kat6b	T	C	14: 21,668,781	V1176A	probably benign	Het
Midn	A	G	10: 80,156,502	K463E	probably damaging	Het
Mier1	A	G	4: 103,139,434	E103G	probably damaging	Het
Muc15	A	G	2: 110,733,815	N232S	possibly damaging	Het
Ncoa2	T	A	1: 13,224,651	E15V	probably damaging	Het
Olfr136	A	G	17: 38,335,844	K229R	probably benign	Het
Olfr667	T	A	7: 104,916,634	T221S	probably benign	Het
Olfr713	A	T	7: 107,036,682	N176Y	probably damaging	Het
Pigf	A	T	17: 87,020,495	F115I	probably benign	Het
Prpsap1	A	T	11: 116,471,491	V355E	probably damaging	Het
Ptprk	G	T	10: 28,483,298		probably benign	Het
Rae1	G	A	2: 173,005,164	R67H	probably damaging	Het
Slc22a22	T	C	15: 57,263,362	T104A	probably benign	Het
Slc38a2	A	T	15: 96,695,287	L137*	probably null	Het
Smgc	A	G	15: 91,841,467		probably benign	Het
Syce3	A	G	15: 89,390,445		probably benign	Het
Syt9	T	A	7: 107,425,136	W79R	probably damaging	Het
Tgoln1	A	C	6: 72,615,991	S169A	probably benign	Het
Thnsl1	A	G	2: 21,211,666	D77G	probably benign	Het
Tsr1	T	A	11: 74,907,941	V712E	probably damaging	Het
Wdr12	C	T	1: 60,089,366		probably benign	Het
Xdh	T	A	17: 73,943,891	N22I	probably damaging	Het
Zfp3	T	A	11: 70,771,569	L118Q	probably benign	Het
Zfp592	A	G	7: 81,037,875	N883D	probably benign	Het
Zfp609	T	A	9: 65,731,201	M250L	probably benign	Het
Zfp94	A	T	7: 24,303,070	S316T	probably damaging	Het
Zfp955b	A	G	17: 33,302,973	N472S	probably benign	Het

Other mutations in Sema3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01022:Sema3a	APN	5	13473466	missense	probably damaging	1.00
IGL01783:Sema3a	APN	5	13561800	missense	probably damaging	1.00
IGL02423:Sema3a	APN	5	13565809	missense	probably damaging	1.00
IGL02728:Sema3a	APN	5	13565914	missense	probably damaging	1.00
IGL02739:Sema3a	APN	5	13451161	missense	probably damaging	1.00
IGL02987:Sema3a	APN	5	13565896	missense	probably damaging	1.00
IGL03106:Sema3a	APN	5	13599488	missense	probably damaging	1.00
R0055:Sema3a	UTSW	5	13400037	missense	possibly damaging	0.92
R0334:Sema3a	UTSW	5	13557301	missense	probably damaging	0.99
R0750:Sema3a	UTSW	5	13557125	critical splice donor site	probably null
R1204:Sema3a	UTSW	5	13523175	critical splice donor site	probably benign
R1221:Sema3a	UTSW	5	13516223	missense	probably benign
R1484:Sema3a	UTSW	5	13473440	missense	probably damaging	1.00
R1663:Sema3a	UTSW	5	13557125	critical splice donor site	probably null
R2079:Sema3a	UTSW	5	13451131	missense	possibly damaging	0.95
R4165:Sema3a	UTSW	5	13473397	critical splice acceptor site	probably null
R4596:Sema3a	UTSW	5	13570157	missense	probably damaging	1.00
R4867:Sema3a	UTSW	5	13451241	missense	probably benign	0.05
R4904:Sema3a	UTSW	5	13581098	missense	probably damaging	1.00
R5107:Sema3a	UTSW	5	13577604	nonsense	probably null
R5327:Sema3a	UTSW	5	13599389	missense	probably benign	0.25
R5343:Sema3a	UTSW	5	13473406	missense	probably damaging	1.00
R5430:Sema3a	UTSW	5	13565763	missense	probably damaging	0.97
R5604:Sema3a	UTSW	5	13473520	critical splice donor site	probably null
R5774:Sema3a	UTSW	5	13523164	missense	probably damaging	1.00
R6057:Sema3a	UTSW	5	13565865	missense	probably damaging	1.00
R6110:Sema3a	UTSW	5	13581001	missense	probably damaging	1.00
R6132:Sema3a	UTSW	5	13523175	critical splice donor site	probably null
R6310:Sema3a	UTSW	5	13557019	missense	probably damaging	1.00
R6754:Sema3a	UTSW	5	13599275	missense	possibly damaging	0.94
R6788:Sema3a	UTSW	5	13597616	missense	possibly damaging	0.95
R6878:Sema3a	UTSW	5	13455544	missense	possibly damaging	0.88
R7411:Sema3a	UTSW	5	13516263	nonsense	probably null
R7501:Sema3a	UTSW	5	13557041	missense	probably damaging	1.00
R7514:Sema3a	UTSW	5	13523126	missense	probably benign	0.03
R7531:Sema3a	UTSW	5	13565838	missense	probably damaging	1.00
R7538:Sema3a	UTSW	5	13561820	missense	probably benign	0.42
R7970:Sema3a	UTSW	5	13599407	missense	possibly damaging	0.93
R8121:Sema3a	UTSW	5	13599247	missense	probably damaging	1.00
R8283:Sema3a	UTSW	5	13400063	missense	probably damaging	0.98
R8434:Sema3a	UTSW	5	13473520	critical splice donor site	probably null
R8918:Sema3a	UTSW	5	13523132	missense	probably damaging	1.00
R9500:Sema3a	UTSW	5	13565887	missense	possibly damaging	0.88
X0064:Sema3a	UTSW	5	13581098	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAACTAGCATCAGGTCAAATGAGCC -3'
(R):5'- GAAAAGCCGTTCCATAAGCAAGTGTG -3'

Sequencing Primer
(F):5'- GCCTGAAAAAGTGAGCTAAGC -3'
(R):5'- ACTTCACACACATAAGTTCAATCTTC -3'

Posted On

2014-08-18