Incidental Mutation 'R0684:Clock'
ID218626
Institutional Source Beutler Lab
Gene Symbol Clock
Ensembl Gene ENSMUSG00000029238
Gene Namecircadian locomotor output cycles kaput
Synonyms5330400M04Rik, bHLHe8, KAT13D
MMRRC Submission 038869-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.796) question?
Stock #R0684 (G1)
Quality Score77
Status Validated
Chromosome5
Chromosomal Location76209868-76304792 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76245518 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 193 (F193L)
Ref Sequence ENSEMBL: ENSMUSP00000143939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075159] [ENSMUST00000202122] [ENSMUST00000202651]
Predicted Effect probably damaging
Transcript: ENSMUST00000075159
AA Change: F193L

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074656
Gene: ENSMUSG00000029238
AA Change: F193L

DomainStartEndE-ValueType
HLH 40 90 7.77e-12 SMART
PAS 109 175 1.88e-6 SMART
PAS 264 330 3.65e-4 SMART
PAC 336 379 7.63e-7 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
low complexity region 640 657 N/A INTRINSIC
low complexity region 738 796 N/A INTRINSIC
low complexity region 818 837 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202122
AA Change: F193L

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144022
Gene: ENSMUSG00000029238
AA Change: F193L

DomainStartEndE-ValueType
TFS2N 34 106 4.1e-3 SMART
HLH 40 90 3.4e-14 SMART
PAS 109 175 9.6e-9 SMART
PAS 264 330 1.8e-6 SMART
PAC 336 379 3.9e-9 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 633 N/A INTRINSIC
low complexity region 639 656 N/A INTRINSIC
low complexity region 737 795 N/A INTRINSIC
low complexity region 817 836 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202651
AA Change: F193L

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143939
Gene: ENSMUSG00000029238
AA Change: F193L

DomainStartEndE-ValueType
HLH 40 90 7.77e-12 SMART
PAS 109 175 1.88e-6 SMART
PAS 264 330 3.65e-4 SMART
PAC 336 379 7.63e-7 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
low complexity region 640 657 N/A INTRINSIC
low complexity region 738 796 N/A INTRINSIC
low complexity region 818 837 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202857
Meta Mutation Damage Score 0.8897 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.1%
  • 20x: 88.8%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: The protein encoded by this gene plays a central role in the regulation of circadian rhythms. The protein encodes a transcription factor of the basic helix-loop-helix (bHLH) family and contains DNA binding histone acetyltransferase activity. The encoded protein forms a heterodimer with Arntl (Bmal1) that binds E-box enhancer elements upstream of Period (Per1, Per2, Per3) and Cryptochrome (Cry1, Cry2) genes and activates transcription of these genes. Per and Cry proteins heterodimerize and repress their own transcription by interacting in a feedback loop with Clock/Arntl complexes. Polymorphisms in this gene may be associated with behavioral changes, obesity, and metabolic syndrome. Two transcripts encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal circadian phase. Mice homozygous for a spontaneous mutation exhibit abnormal circadian rhythm, reproduction, behavior, hair cycle, macronutrient absorption, and metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik C T 9: 36,637,880 G28E probably benign Het
Adam4 A T 12: 81,419,654 L731H probably damaging Het
Adora2b C T 11: 62,249,169 A23V probably benign Het
Ankrd17 T C 5: 90,263,998 I1336V probably damaging Het
Asxl1 G A 2: 153,397,522 R410H probably damaging Het
Atp8a2 T C 14: 60,023,144 E419G probably benign Het
Atxn1l A T 8: 109,732,384 N415K probably damaging Het
Bcl2l12 T A 7: 44,996,601 T65S probably benign Het
Bdh2 A G 3: 135,291,013 I90V probably benign Het
Bsph1 T A 7: 13,473,063 N121K probably damaging Het
Cd96 T C 16: 46,117,790 Y104C possibly damaging Het
Chdh T C 14: 30,031,613 W160R probably damaging Het
Copz1 A G 15: 103,296,531 probably null Het
Cyp2c38 T C 19: 39,391,056 T450A probably damaging Het
Cyp2d34 A T 15: 82,617,550 I253K probably benign Het
Dhrs13 G T 11: 78,036,963 A212S probably damaging Het
Ecsit T C 9: 22,076,500 N81S probably benign Het
Efl1 A G 7: 82,651,886 T33A probably damaging Het
Emid1 T C 11: 5,143,866 R92G probably damaging Het
Ermp1 A G 19: 29,632,541 probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Hps5 A G 7: 46,783,469 probably null Het
Hsd17b3 T C 13: 64,089,068 M21V probably benign Het
Kat6b T C 14: 21,668,781 V1176A probably benign Het
Midn A G 10: 80,156,502 K463E probably damaging Het
Mier1 A G 4: 103,139,434 E103G probably damaging Het
Muc15 A G 2: 110,733,815 N232S possibly damaging Het
Ncoa2 T A 1: 13,224,651 E15V probably damaging Het
Olfr136 A G 17: 38,335,844 K229R probably benign Het
Olfr667 T A 7: 104,916,634 T221S probably benign Het
Olfr713 A T 7: 107,036,682 N176Y probably damaging Het
Pigf A T 17: 87,020,495 F115I probably benign Het
Prpsap1 A T 11: 116,471,491 V355E probably damaging Het
Ptprk G T 10: 28,483,298 probably benign Het
Rae1 G A 2: 173,005,164 R67H probably damaging Het
Sema3a G A 5: 13,556,527 probably null Het
Slc22a22 T C 15: 57,263,362 T104A probably benign Het
Slc38a2 A T 15: 96,695,287 L137* probably null Het
Smgc A G 15: 91,841,467 probably benign Het
Syce3 A G 15: 89,390,445 probably benign Het
Syt9 T A 7: 107,425,136 W79R probably damaging Het
Tgoln1 A C 6: 72,615,991 S169A probably benign Het
Thnsl1 A G 2: 21,211,666 D77G probably benign Het
Tsr1 T A 11: 74,907,941 V712E probably damaging Het
Wdr12 C T 1: 60,089,366 probably benign Het
Xdh T A 17: 73,943,891 N22I probably damaging Het
Zfp3 T A 11: 70,771,569 L118Q probably benign Het
Zfp592 A G 7: 81,037,875 N883D probably benign Het
Zfp609 T A 9: 65,731,201 M250L probably benign Het
Zfp94 A T 7: 24,303,070 S316T probably damaging Het
Zfp955b A G 17: 33,302,973 N472S probably benign Het
Other mutations in Clock
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Clock APN 5 76229464 missense probably benign 0.17
IGL00725:Clock APN 5 76254413 nonsense probably null
IGL01304:Clock APN 5 76266355 critical splice donor site probably null
IGL01369:Clock APN 5 76237086 missense probably benign 0.30
IGL01542:Clock APN 5 76231475 missense possibly damaging 0.82
IGL02541:Clock APN 5 76262672 splice site probably null
IGL02602:Clock APN 5 76254426 missense probably null 1.00
IGL02602:Clock APN 5 76254427 missense probably damaging 1.00
IGL03186:Clock APN 5 76243082 missense probably damaging 0.98
IGL03309:Clock APN 5 76231394 critical splice donor site probably null
R6760_Clock_188 UTSW 5 76226976 missense unknown
uhr UTSW 5 76229554 nonsense probably null
R0304:Clock UTSW 5 76226985 missense unknown
R0593:Clock UTSW 5 76265836 missense probably benign 0.25
R0654:Clock UTSW 5 76227129 missense possibly damaging 0.95
R0707:Clock UTSW 5 76227129 missense possibly damaging 0.95
R0751:Clock UTSW 5 76229361 missense possibly damaging 0.75
R0865:Clock UTSW 5 76266424 splice site probably benign
R0920:Clock UTSW 5 76230320 missense possibly damaging 0.80
R1396:Clock UTSW 5 76266802 missense probably benign 0.00
R1450:Clock UTSW 5 76262731 nonsense probably null
R1487:Clock UTSW 5 76266354 splice site probably null
R1574:Clock UTSW 5 76242832 missense probably damaging 1.00
R1574:Clock UTSW 5 76242832 missense probably damaging 1.00
R1858:Clock UTSW 5 76240909 missense possibly damaging 0.92
R1872:Clock UTSW 5 76248462 missense possibly damaging 0.67
R1905:Clock UTSW 5 76266888 splice site probably benign
R1937:Clock UTSW 5 76229493 missense probably damaging 0.99
R2411:Clock UTSW 5 76231513 missense probably benign 0.08
R2887:Clock UTSW 5 76245273 missense probably damaging 0.99
R3410:Clock UTSW 5 76229554 nonsense probably null
R4514:Clock UTSW 5 76230199 missense probably benign 0.00
R4598:Clock UTSW 5 76235810 missense probably benign 0.00
R4599:Clock UTSW 5 76235810 missense probably benign 0.00
R4795:Clock UTSW 5 76265916 missense probably damaging 1.00
R4796:Clock UTSW 5 76265916 missense probably damaging 1.00
R4973:Clock UTSW 5 76254411 missense possibly damaging 0.62
R5204:Clock UTSW 5 76243170 splice site probably null
R5271:Clock UTSW 5 76241954 missense probably damaging 1.00
R5547:Clock UTSW 5 76230338 missense probably benign 0.02
R5630:Clock UTSW 5 76230338 missense probably benign 0.02
R5631:Clock UTSW 5 76230338 missense probably benign 0.02
R5632:Clock UTSW 5 76230338 missense probably benign 0.02
R5787:Clock UTSW 5 76237051 missense probably damaging 1.00
R6274:Clock UTSW 5 76237153 missense probably benign 0.45
R6578:Clock UTSW 5 76216709 missense unknown
R6622:Clock UTSW 5 76241954 missense probably damaging 1.00
R6760:Clock UTSW 5 76226976 missense unknown
R6793:Clock UTSW 5 76237120 frame shift probably null
R7406:Clock UTSW 5 76266845 start codon destroyed probably null 0.26
R7414:Clock UTSW 5 76262764 missense probably benign 0.00
R7560:Clock UTSW 5 76242891 splice site probably null
R7593:Clock UTSW 5 76236298 missense possibly damaging 0.80
R7640:Clock UTSW 5 76248378 missense possibly damaging 0.71
R7708:Clock UTSW 5 76266409 missense probably benign 0.00
R7713:Clock UTSW 5 76245420 critical splice donor site probably null
R7807:Clock UTSW 5 76243135 missense probably benign 0.01
R8171:Clock UTSW 5 76266414 missense possibly damaging 0.94
R8190:Clock UTSW 5 76227204 missense probably damaging 0.98
R8225:Clock UTSW 5 76241912 missense probably damaging 0.99
R8309:Clock UTSW 5 76254422 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GTGTGCGTTGTATAGTTCCTTCAAAACC -3'
(R):5'- AGTCCAGGCTAGACTGTTACCAAGAG -3'

Sequencing Primer
(F):5'- CCTTCAAAACCATTGTGTGTTG -3'
(R):5'- GGCCTTAGCTTTAAATAAAGGACAG -3'
Posted On2014-08-18