Incidental Mutation 'R0684:Efl1'
ID 218629
Institutional Source Beutler Lab
Gene Symbol Efl1
Ensembl Gene ENSMUSG00000038563
Gene Name elongation factor like GTPase 1
Synonyms D7Ertd791e, 6030468D11Rik, 4932434J20Rik, Eftud1
MMRRC Submission 038869-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.878) question?
Stock # R0684 (G1)
Quality Score 61
Status Validated
Chromosome 7
Chromosomal Location 82297822-82427060 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 82301094 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 33 (T33A)
Ref Sequence ENSEMBL: ENSMUSP00000146350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000056728] [ENSMUST00000126478] [ENSMUST00000141726] [ENSMUST00000179489] [ENSMUST00000207868] [ENSMUST00000207693]
AlphaFold Q8C0D5
Predicted Effect probably damaging
Transcript: ENSMUST00000039881
AA Change: T33A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: T33A

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056728
SMART Domains Protein: ENSMUSP00000057993
Gene: ENSMUSG00000038570

DomainStartEndE-ValueType
Pfam:STOP 4 201 3.6e-42 PFAM
Pfam:STOP 237 390 4.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125245
Predicted Effect probably benign
Transcript: ENSMUST00000126478
Predicted Effect probably damaging
Transcript: ENSMUST00000141726
AA Change: T33A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121909
Gene: ENSMUSG00000038563
AA Change: T33A

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 222 2.3e-57 PFAM
Pfam:MMR_HSR1 21 147 2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151632
Predicted Effect probably damaging
Transcript: ENSMUST00000179489
AA Change: T33A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: T33A

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207868
AA Change: T33A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000207693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156720
Meta Mutation Damage Score 0.8511 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.1%
  • 20x: 88.8%
Validation Efficiency 100% (69/69)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,466,428 (GRCm39) L731H probably damaging Het
Adora2b C T 11: 62,139,995 (GRCm39) A23V probably benign Het
Ankrd17 T C 5: 90,411,857 (GRCm39) I1336V probably damaging Het
Asxl1 G A 2: 153,239,442 (GRCm39) R410H probably damaging Het
Atp8a2 T C 14: 60,260,593 (GRCm39) E419G probably benign Het
Atxn1l A T 8: 110,459,016 (GRCm39) N415K probably damaging Het
Bcl2l12 T A 7: 44,646,025 (GRCm39) T65S probably benign Het
Bdh2 A G 3: 134,996,774 (GRCm39) I90V probably benign Het
Bsph1 T A 7: 13,206,988 (GRCm39) N121K probably damaging Het
Cd96 T C 16: 45,938,153 (GRCm39) Y104C possibly damaging Het
Chdh T C 14: 29,753,570 (GRCm39) W160R probably damaging Het
Clock A G 5: 76,393,365 (GRCm39) F193L probably damaging Het
Copz1 A G 15: 103,204,958 (GRCm39) probably null Het
Cyp2c38 T C 19: 39,379,500 (GRCm39) T450A probably damaging Het
Cyp2d34 A T 15: 82,501,751 (GRCm39) I253K probably benign Het
Dhrs13 G T 11: 77,927,789 (GRCm39) A212S probably damaging Het
Ecsit T C 9: 21,987,796 (GRCm39) N81S probably benign Het
Emid1 T C 11: 5,093,866 (GRCm39) R92G probably damaging Het
Ermp1 A G 19: 29,609,941 (GRCm39) probably benign Het
Fn1 A T 1: 71,634,968 (GRCm39) probably null Het
Hps5 A G 7: 46,432,893 (GRCm39) probably null Het
Hsd17b3 T C 13: 64,236,882 (GRCm39) M21V probably benign Het
Kat6b T C 14: 21,718,849 (GRCm39) V1176A probably benign Het
Midn A G 10: 79,992,336 (GRCm39) K463E probably damaging Het
Mier1 A G 4: 102,996,631 (GRCm39) E103G probably damaging Het
Muc15 A G 2: 110,564,160 (GRCm39) N232S possibly damaging Het
Ncoa2 T A 1: 13,294,875 (GRCm39) E15V probably damaging Het
Or10a5 A T 7: 106,635,889 (GRCm39) N176Y probably damaging Het
Or2n1d A G 17: 38,646,735 (GRCm39) K229R probably benign Het
Or52n2b T A 7: 104,565,841 (GRCm39) T221S probably benign Het
Pate14 C T 9: 36,549,176 (GRCm39) G28E probably benign Het
Pigf A T 17: 87,327,923 (GRCm39) F115I probably benign Het
Prpsap1 A T 11: 116,362,317 (GRCm39) V355E probably damaging Het
Ptprk G T 10: 28,359,294 (GRCm39) probably benign Het
Rae1 G A 2: 172,846,957 (GRCm39) R67H probably damaging Het
Sema3a G A 5: 13,606,494 (GRCm39) probably null Het
Slc22a22 T C 15: 57,126,758 (GRCm39) T104A probably benign Het
Slc38a2 A T 15: 96,593,168 (GRCm39) L137* probably null Het
Smgc A G 15: 91,725,670 (GRCm39) probably benign Het
Syce3 A G 15: 89,274,648 (GRCm39) probably benign Het
Syt9 T A 7: 107,024,343 (GRCm39) W79R probably damaging Het
Tgoln1 A C 6: 72,592,974 (GRCm39) S169A probably benign Het
Thnsl1 A G 2: 21,216,477 (GRCm39) D77G probably benign Het
Tsr1 T A 11: 74,798,767 (GRCm39) V712E probably damaging Het
Wdr12 C T 1: 60,128,525 (GRCm39) probably benign Het
Xdh T A 17: 74,250,886 (GRCm39) N22I probably damaging Het
Zfp3 T A 11: 70,662,395 (GRCm39) L118Q probably benign Het
Zfp592 A G 7: 80,687,623 (GRCm39) N883D probably benign Het
Zfp609 T A 9: 65,638,483 (GRCm39) M250L probably benign Het
Zfp94 A T 7: 24,002,495 (GRCm39) S316T probably damaging Het
Zfp955b A G 17: 33,521,947 (GRCm39) N472S probably benign Het
Other mutations in Efl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Efl1 APN 7 82,307,319 (GRCm39) missense probably damaging 1.00
IGL00696:Efl1 APN 7 82,301,080 (GRCm39) splice site probably benign
IGL01344:Efl1 APN 7 82,330,688 (GRCm39) splice site probably benign
IGL01871:Efl1 APN 7 82,412,527 (GRCm39) missense possibly damaging 0.64
IGL01941:Efl1 APN 7 82,347,184 (GRCm39) missense probably benign 0.17
IGL02104:Efl1 APN 7 82,307,263 (GRCm39) critical splice acceptor site probably null
IGL02150:Efl1 APN 7 82,335,899 (GRCm39) missense probably benign
IGL02484:Efl1 APN 7 82,332,247 (GRCm39) missense probably damaging 0.98
IGL03140:Efl1 APN 7 82,342,089 (GRCm39) missense probably benign 0.00
IGL03188:Efl1 APN 7 82,320,909 (GRCm39) missense probably damaging 1.00
IGL03014:Efl1 UTSW 7 82,301,094 (GRCm39) missense probably damaging 1.00
PIT4469001:Efl1 UTSW 7 82,307,373 (GRCm39) missense probably benign 0.14
R0148:Efl1 UTSW 7 82,320,878 (GRCm39) missense probably damaging 1.00
R0226:Efl1 UTSW 7 82,342,219 (GRCm39) splice site probably benign
R0638:Efl1 UTSW 7 82,301,095 (GRCm39) missense probably damaging 1.00
R1018:Efl1 UTSW 7 82,412,221 (GRCm39) missense possibly damaging 0.94
R1290:Efl1 UTSW 7 82,320,936 (GRCm39) missense probably damaging 1.00
R1720:Efl1 UTSW 7 82,332,929 (GRCm39) missense possibly damaging 0.50
R1933:Efl1 UTSW 7 82,412,325 (GRCm39) nonsense probably null
R1973:Efl1 UTSW 7 82,412,085 (GRCm39) missense probably damaging 1.00
R2016:Efl1 UTSW 7 82,402,917 (GRCm39) missense probably damaging 1.00
R2124:Efl1 UTSW 7 82,342,121 (GRCm39) missense probably damaging 1.00
R2290:Efl1 UTSW 7 82,426,878 (GRCm39) missense probably damaging 1.00
R2415:Efl1 UTSW 7 82,347,175 (GRCm39) missense probably damaging 1.00
R3545:Efl1 UTSW 7 82,412,018 (GRCm39) missense probably benign 0.00
R3688:Efl1 UTSW 7 82,412,178 (GRCm39) missense probably benign 0.00
R4092:Efl1 UTSW 7 82,412,035 (GRCm39) missense probably benign 0.00
R4207:Efl1 UTSW 7 82,400,024 (GRCm39) missense probably damaging 0.98
R4347:Efl1 UTSW 7 82,347,174 (GRCm39) missense probably damaging 1.00
R4425:Efl1 UTSW 7 82,412,491 (GRCm39) missense probably damaging 0.99
R4816:Efl1 UTSW 7 82,320,927 (GRCm39) missense probably damaging 1.00
R4858:Efl1 UTSW 7 82,320,835 (GRCm39) missense probably damaging 1.00
R5077:Efl1 UTSW 7 82,307,295 (GRCm39) missense probably damaging 1.00
R5185:Efl1 UTSW 7 82,421,707 (GRCm39) missense probably damaging 1.00
R5319:Efl1 UTSW 7 82,323,714 (GRCm39) missense probably damaging 1.00
R5771:Efl1 UTSW 7 82,341,732 (GRCm39) missense probably benign 0.26
R5857:Efl1 UTSW 7 82,412,397 (GRCm39) missense probably benign
R5956:Efl1 UTSW 7 82,301,107 (GRCm39) missense probably damaging 1.00
R6433:Efl1 UTSW 7 82,323,776 (GRCm39) missense probably damaging 1.00
R7131:Efl1 UTSW 7 82,307,272 (GRCm39) missense probably damaging 1.00
R7143:Efl1 UTSW 7 82,411,888 (GRCm39) missense probably damaging 1.00
R7312:Efl1 UTSW 7 82,330,652 (GRCm39) missense probably benign 0.10
R7409:Efl1 UTSW 7 82,347,121 (GRCm39) missense probably damaging 0.98
R7422:Efl1 UTSW 7 82,330,587 (GRCm39) missense probably damaging 1.00
R7453:Efl1 UTSW 7 82,330,675 (GRCm39) missense possibly damaging 0.76
R7504:Efl1 UTSW 7 82,332,257 (GRCm39) missense probably damaging 1.00
R7884:Efl1 UTSW 7 82,307,307 (GRCm39) missense probably damaging 1.00
R7969:Efl1 UTSW 7 82,342,178 (GRCm39) missense probably benign 0.03
R8394:Efl1 UTSW 7 82,411,986 (GRCm39) missense probably benign 0.00
R8702:Efl1 UTSW 7 82,399,998 (GRCm39) critical splice acceptor site probably null
R8924:Efl1 UTSW 7 82,412,161 (GRCm39) missense probably benign 0.03
R9463:Efl1 UTSW 7 82,426,733 (GRCm39) missense probably damaging 1.00
R9762:Efl1 UTSW 7 82,412,596 (GRCm39) missense probably benign 0.09
Z1088:Efl1 UTSW 7 82,342,058 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGTCAGCCAGGGTCACACAC -3'
(R):5'- TGAAGACTTGCGATCATGGAACAGC -3'

Sequencing Primer
(F):5'- TGATGGTTTACCCAGAATGCC -3'
(R):5'- CGCAATATGGAAGTGAGCTTTTCTC -3'
Posted On 2014-08-18