Mutagenetix > Incidental Mutations

Incidental Mutation 'R0135:Them4'

21863

Institutional Source

Beutler Lab

Gene Symbol

Them4

Ensembl Gene

ENSMUSG00000028145

Gene Name

thioesterase superfamily member 4

Synonyms

2700077M13Rik, 4921507I02Rik

MMRRC Submission

038420-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0135 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

94310089-94332540 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 94323570 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000062841 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049822]

AlphaFold

Q3UUI3

Predicted Effect

probably benign
Transcript: ENSMUST00000049822

SMART Domains

Protein: ENSMUSP00000062841
Gene: ENSMUSG00000028145

Domain	Start	End	E-Value	Type
low complexity region	13	25	N/A	INTRINSIC
Pfam:4HBT	139	213	8.1e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198494

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.5%
20x: 93.6%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase B (PKB) is a major downstream target of receptor tyrosine kinases that signal via phosphatidylinositol 3-kinase. Upon cell stimulation, PKB is translocated to the plasma membrane, where it is phosphorylated in the C-terminal regulatory domain. The protein encoded by this gene negatively regulates PKB activity by inhibiting phosphorylation. Transcription of this gene is commonly downregulated in glioblastomas. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit elongated mitochondria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	T	C	7: 34,245,957	I499M	probably damaging	Het
4932438H23Rik	A	G	16: 91,055,627	F207S	probably damaging	Het
Abhd8	T	A	8: 71,458,074	K363N	probably benign	Het
Adam11	T	A	11: 102,776,573	V653E	probably damaging	Het
Adam18	T	C	8: 24,665,542	S154G	possibly damaging	Het
Adamts1	T	C	16: 85,798,703		probably benign	Het
Afm	G	T	5: 90,550,322	V528L	probably benign	Het
Alox12b	C	T	11: 69,162,748	H145Y	probably benign	Het
Ankmy2	C	A	12: 36,170,435		probably benign	Het
Aox3	G	A	1: 58,125,088		probably benign	Het
Arhgap28	T	C	17: 67,864,588	D396G	probably damaging	Het
B430203G13Rik	T	C	12: 17,924,488		noncoding transcript	Het
Bean1	C	T	8: 104,217,175	P121S	probably damaging	Het
Bok	T	C	1: 93,686,507	S21P	probably damaging	Het
Brwd1	A	C	16: 96,047,104	N572K	probably damaging	Het
C5ar1	A	T	7: 16,248,939	V52E	probably damaging	Het
Cdr2l	C	A	11: 115,393,671	P278T	probably damaging	Het
Cnga4	T	A	7: 105,406,848	I219N	probably damaging	Het
Cpne2	C	T	8: 94,554,925		probably benign	Het
D430041D05Rik	A	G	2: 104,255,034	S1057P	possibly damaging	Het
Def8	G	A	8: 123,456,495	A278T	probably damaging	Het
Dgcr2	A	G	16: 17,858,442	S152P	probably damaging	Het
Dstyk	A	T	1: 132,462,934	D828V	probably damaging	Het
Eml2	T	C	7: 19,203,952	S582P	probably damaging	Het
Engase	T	C	11: 118,484,478	Y359H	possibly damaging	Het
Fat3	T	C	9: 16,006,777	D1450G	probably damaging	Het
Fbxw8	A	T	5: 118,070,487	I467N	probably damaging	Het
Fhdc1	A	T	3: 84,445,618	Y767N	probably damaging	Het
Flii	T	C	11: 60,723,378	D105G	probably damaging	Het
Gaa	C	T	11: 119,278,890	T590I	probably benign	Het
Gabrr1	T	A	4: 33,160,224	S303T	probably damaging	Het
Gif	G	T	19: 11,757,754	C246F	probably damaging	Het
Glp1r	A	G	17: 30,924,577	I196V	probably benign	Het
Gm884	C	A	11: 103,618,047		probably benign	Het
Grm6	G	A	11: 50,853,223	E174K	probably damaging	Het
Helz2	A	C	2: 181,232,269	L2144R	probably damaging	Het
Itpr1	A	T	6: 108,488,482		probably benign	Het
Kcns1	A	T	2: 164,164,955	S363T	possibly damaging	Het
Kif13a	A	T	13: 46,793,943	V855E	probably damaging	Het
Krt42	T	C	11: 100,263,159	T424A	possibly damaging	Het
Lct	A	T	1: 128,285,123	F1931Y	probably damaging	Het
Lrp1b	A	T	2: 41,269,239	V1563E	probably damaging	Het
Lzts2	T	C	19: 45,026,187		probably benign	Het
Mamdc4	C	T	2: 25,566,920	R615Q	possibly damaging	Het
Mei1	C	T	15: 82,071,969	Q133*	probably null	Het
Mif4gd	T	C	11: 115,608,465	E197G	probably damaging	Het
Ncdn	A	T	4: 126,746,669	S544T	probably benign	Het
Nfat5	C	T	8: 107,339,075	R156W	probably damaging	Het
Olfr68	T	A	7: 103,777,763	D194V	probably damaging	Het
Padi6	T	C	4: 140,737,352	T114A	probably benign	Het
Pigk	G	T	3: 152,744,706		probably benign	Het
Pkd1	T	A	17: 24,565,071	F197Y	possibly damaging	Het
Pld5	A	T	1: 175,970,589	F415I	probably damaging	Het
Pnpla5	A	G	15: 84,113,949	L364P	probably damaging	Het
Prrc2c	G	A	1: 162,715,483		probably benign	Het
Rab32	C	T	10: 10,550,840	D121N	probably damaging	Het
Rab44	A	T	17: 29,138,132	T79S	probably benign	Het
Reln	G	T	5: 22,128,649	N258K	probably damaging	Het
Retsat	A	G	6: 72,602,772	T177A	probably damaging	Het
Serpinf2	T	A	11: 75,436,393	H236L	probably damaging	Het
Slc26a6	A	T	9: 108,860,595		probably benign	Het
Slitrk1	T	A	14: 108,911,629	E550V	probably benign	Het
Smarcd3	A	T	5: 24,595,499		probably benign	Het
Spdye4a	A	C	5: 143,225,102		probably null	Het
Susd2	C	T	10: 75,638,514	G572D	probably damaging	Het
Tcaf3	C	T	6: 42,589,758	R799K	probably benign	Het
Tg	A	G	15: 66,694,870	S1256G	probably benign	Het
Tmem210	C	T	2: 25,288,468	A47V	probably damaging	Het
Tnfrsf1b	A	G	4: 145,229,046	Y47H	probably benign	Het
Tnik	T	G	3: 28,607,245	N598K	possibly damaging	Het
Ttc3	A	G	16: 94,462,268	N1498D	possibly damaging	Het
Ttll4	C	A	1: 74,679,928	H313N	possibly damaging	Het
Vipr2	A	G	12: 116,142,827	I348V	probably benign	Het
Vps13a	A	G	19: 16,780,765	V2A	probably damaging	Het
Vps72	G	A	3: 95,119,197	R151K	probably damaging	Het
Zfp106	A	G	2: 120,520,487	V1561A	probably damaging	Het
Zfp658	C	A	7: 43,573,595	Y431*	probably null	Het
Zkscan2	T	C	7: 123,480,641	K698E	possibly damaging	Het

Other mutations in Them4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02403:Them4	APN	3	94323671	missense	probably damaging	1.00
R0586:Them4	UTSW	3	94329794	missense	possibly damaging	0.95
R4345:Them4	UTSW	3	94329865	missense	possibly damaging	0.93
R4998:Them4	UTSW	3	94329781	missense	probably damaging	1.00
R5214:Them4	UTSW	3	94317511	missense	probably benign	0.13
R5649:Them4	UTSW	3	94331544	missense	possibly damaging	0.62
R6041:Them4	UTSW	3	94317499	missense	possibly damaging	0.93
R6814:Them4	UTSW	3	94324371	missense	probably damaging	1.00
R6872:Them4	UTSW	3	94324371	missense	probably damaging	1.00
R7611:Them4	UTSW	3	94331558	missense	possibly damaging	0.96
R8505:Them4	UTSW	3	94317540	missense	probably benign	0.00
R8815:Them4	UTSW	3	94324303	missense	probably damaging	1.00
R9290:Them4	UTSW	3	94324323	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACGCCAAGAAGAGTTTCTGACTGTA -3'
(R):5'- GCAGGTGAAGTCCTCCTTGAAACAA -3'

Sequencing Primer
(F):5'- aaacttctcatcttctacctccc -3'
(R):5'- TTGAAACAAGGAGACCGTCCTC -3'

Posted On

2013-04-12