Incidental Mutation 'R0684:Hsd17b3'
ID218634
Institutional Source Beutler Lab
Gene Symbol Hsd17b3
Ensembl Gene ENSMUSG00000033122
Gene Namehydroxysteroid (17-beta) dehydrogenase 3
Synonyms17(beta)HSD type 3
MMRRC Submission 038869-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0684 (G1)
Quality Score23
Status Validated
Chromosome13
Chromosomal Location64058266-64089230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64089068 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 21 (M21V)
Ref Sequence ENSEMBL: ENSMUSP00000152274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039832] [ENSMUST00000166224] [ENSMUST00000222783] [ENSMUST00000222810]
Predicted Effect probably benign
Transcript: ENSMUST00000039832
AA Change: M21V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044217
Gene: ENSMUSG00000033122
AA Change: M21V

DomainStartEndE-ValueType
Pfam:adh_short 45 213 3.4e-26 PFAM
Pfam:adh_short_C2 51 272 1.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166224
AA Change: M21V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132011
Gene: ENSMUSG00000033122
AA Change: M21V

DomainStartEndE-ValueType
Pfam:adh_short 45 240 2.4e-48 PFAM
Pfam:adh_short_C2 51 272 3.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222783
AA Change: M21V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000222810
AA Change: M21V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.1%
  • 20x: 88.8%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This isoform of 17 beta-hydroxysteroid dehydrogenase is expressed predominantly in the testis and catalyzes the conversion of androstenedione to testosterone. It preferentially uses NADP as cofactor. Deficiency can result in male pseudohermaphroditism with gynecomastia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095E13Rik C T 9: 36,637,880 G28E probably benign Het
Adam4 A T 12: 81,419,654 L731H probably damaging Het
Adora2b C T 11: 62,249,169 A23V probably benign Het
Ankrd17 T C 5: 90,263,998 I1336V probably damaging Het
Asxl1 G A 2: 153,397,522 R410H probably damaging Het
Atp8a2 T C 14: 60,023,144 E419G probably benign Het
Atxn1l A T 8: 109,732,384 N415K probably damaging Het
Bcl2l12 T A 7: 44,996,601 T65S probably benign Het
Bdh2 A G 3: 135,291,013 I90V probably benign Het
Bsph1 T A 7: 13,473,063 N121K probably damaging Het
Cd96 T C 16: 46,117,790 Y104C possibly damaging Het
Chdh T C 14: 30,031,613 W160R probably damaging Het
Clock A G 5: 76,245,518 F193L probably damaging Het
Copz1 A G 15: 103,296,531 probably null Het
Cyp2c38 T C 19: 39,391,056 T450A probably damaging Het
Cyp2d34 A T 15: 82,617,550 I253K probably benign Het
Dhrs13 G T 11: 78,036,963 A212S probably damaging Het
Ecsit T C 9: 22,076,500 N81S probably benign Het
Efl1 A G 7: 82,651,886 T33A probably damaging Het
Emid1 T C 11: 5,143,866 R92G probably damaging Het
Ermp1 A G 19: 29,632,541 probably benign Het
Fn1 A T 1: 71,595,809 probably null Het
Hps5 A G 7: 46,783,469 probably null Het
Kat6b T C 14: 21,668,781 V1176A probably benign Het
Midn A G 10: 80,156,502 K463E probably damaging Het
Mier1 A G 4: 103,139,434 E103G probably damaging Het
Muc15 A G 2: 110,733,815 N232S possibly damaging Het
Ncoa2 T A 1: 13,224,651 E15V probably damaging Het
Olfr136 A G 17: 38,335,844 K229R probably benign Het
Olfr667 T A 7: 104,916,634 T221S probably benign Het
Olfr713 A T 7: 107,036,682 N176Y probably damaging Het
Pigf A T 17: 87,020,495 F115I probably benign Het
Prpsap1 A T 11: 116,471,491 V355E probably damaging Het
Ptprk G T 10: 28,483,298 probably benign Het
Rae1 G A 2: 173,005,164 R67H probably damaging Het
Sema3a G A 5: 13,556,527 probably null Het
Slc22a22 T C 15: 57,263,362 T104A probably benign Het
Slc38a2 A T 15: 96,695,287 L137* probably null Het
Smgc A G 15: 91,841,467 probably benign Het
Syce3 A G 15: 89,390,445 probably benign Het
Syt9 T A 7: 107,425,136 W79R probably damaging Het
Tgoln1 A C 6: 72,615,991 S169A probably benign Het
Thnsl1 A G 2: 21,211,666 D77G probably benign Het
Tsr1 T A 11: 74,907,941 V712E probably damaging Het
Wdr12 C T 1: 60,089,366 probably benign Het
Xdh T A 17: 73,943,891 N22I probably damaging Het
Zfp3 T A 11: 70,771,569 L118Q probably benign Het
Zfp592 A G 7: 81,037,875 N883D probably benign Het
Zfp609 T A 9: 65,731,201 M250L probably benign Het
Zfp94 A T 7: 24,303,070 S316T probably damaging Het
Zfp955b A G 17: 33,302,973 N472S probably benign Het
Other mutations in Hsd17b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Hsd17b3 APN 13 64062905 missense probably damaging 1.00
IGL02221:Hsd17b3 APN 13 64089051 missense probably benign 0.01
IGL02257:Hsd17b3 APN 13 64059462 missense probably benign 0.14
IGL02745:Hsd17b3 APN 13 64087176 missense probably benign 0.01
IGL03189:Hsd17b3 APN 13 64063087 critical splice donor site probably null
hermine UTSW 13 64062906 missense probably damaging 1.00
IGL02988:Hsd17b3 UTSW 13 64089100 missense probably damaging 0.96
R0116:Hsd17b3 UTSW 13 64058589 missense possibly damaging 0.87
R0659:Hsd17b3 UTSW 13 64073936 missense possibly damaging 0.87
R0834:Hsd17b3 UTSW 13 64089122 missense probably benign 0.00
R3750:Hsd17b3 UTSW 13 64063179 splice site probably null
R3845:Hsd17b3 UTSW 13 64089062 missense possibly damaging 0.94
R3973:Hsd17b3 UTSW 13 64059486 missense probably damaging 1.00
R4602:Hsd17b3 UTSW 13 64063170 critical splice acceptor site probably null
R5027:Hsd17b3 UTSW 13 64062906 missense probably damaging 1.00
R5470:Hsd17b3 UTSW 13 64073899 missense probably damaging 1.00
R5897:Hsd17b3 UTSW 13 64088985 critical splice donor site probably null
R5992:Hsd17b3 UTSW 13 64059470 unclassified probably null
R6898:Hsd17b3 UTSW 13 64059525 missense probably benign 0.06
R7297:Hsd17b3 UTSW 13 64076351 missense probably damaging 1.00
R7555:Hsd17b3 UTSW 13 64072002 missense probably benign 0.17
Z1176:Hsd17b3 UTSW 13 64063138 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACATGTTGTGCGGAGTCACAGAG -3'
(R):5'- AGATGCCTGCGAATCACAAGGTTAC -3'

Sequencing Primer
(F):5'- TCACAGAGGCATTCTGAGAC -3'
(R):5'- TCTAAATGCTCCCAGATACATGG -3'
Posted On2014-08-18