Incidental Mutation 'R0684:Xdh'
ID 218638
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms Xox-1, XO, Xor, Xox1, xanthine oxidase
MMRRC Submission 038869-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.453) question?
Stock # R0684 (G1)
Quality Score 72
Status Validated
Chromosome 17
Chromosomal Location 74190890-74257191 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 74250886 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 22 (N22I)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably damaging
Transcript: ENSMUST00000024866
AA Change: N22I

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: N22I

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Meta Mutation Damage Score 0.1943 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.1%
  • 20x: 88.8%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,466,428 (GRCm39) L731H probably damaging Het
Adora2b C T 11: 62,139,995 (GRCm39) A23V probably benign Het
Ankrd17 T C 5: 90,411,857 (GRCm39) I1336V probably damaging Het
Asxl1 G A 2: 153,239,442 (GRCm39) R410H probably damaging Het
Atp8a2 T C 14: 60,260,593 (GRCm39) E419G probably benign Het
Atxn1l A T 8: 110,459,016 (GRCm39) N415K probably damaging Het
Bcl2l12 T A 7: 44,646,025 (GRCm39) T65S probably benign Het
Bdh2 A G 3: 134,996,774 (GRCm39) I90V probably benign Het
Bsph1 T A 7: 13,206,988 (GRCm39) N121K probably damaging Het
Cd96 T C 16: 45,938,153 (GRCm39) Y104C possibly damaging Het
Chdh T C 14: 29,753,570 (GRCm39) W160R probably damaging Het
Clock A G 5: 76,393,365 (GRCm39) F193L probably damaging Het
Copz1 A G 15: 103,204,958 (GRCm39) probably null Het
Cyp2c38 T C 19: 39,379,500 (GRCm39) T450A probably damaging Het
Cyp2d34 A T 15: 82,501,751 (GRCm39) I253K probably benign Het
Dhrs13 G T 11: 77,927,789 (GRCm39) A212S probably damaging Het
Ecsit T C 9: 21,987,796 (GRCm39) N81S probably benign Het
Efl1 A G 7: 82,301,094 (GRCm39) T33A probably damaging Het
Emid1 T C 11: 5,093,866 (GRCm39) R92G probably damaging Het
Ermp1 A G 19: 29,609,941 (GRCm39) probably benign Het
Fn1 A T 1: 71,634,968 (GRCm39) probably null Het
Hps5 A G 7: 46,432,893 (GRCm39) probably null Het
Hsd17b3 T C 13: 64,236,882 (GRCm39) M21V probably benign Het
Kat6b T C 14: 21,718,849 (GRCm39) V1176A probably benign Het
Midn A G 10: 79,992,336 (GRCm39) K463E probably damaging Het
Mier1 A G 4: 102,996,631 (GRCm39) E103G probably damaging Het
Muc15 A G 2: 110,564,160 (GRCm39) N232S possibly damaging Het
Ncoa2 T A 1: 13,294,875 (GRCm39) E15V probably damaging Het
Or10a5 A T 7: 106,635,889 (GRCm39) N176Y probably damaging Het
Or2n1d A G 17: 38,646,735 (GRCm39) K229R probably benign Het
Or52n2b T A 7: 104,565,841 (GRCm39) T221S probably benign Het
Pate14 C T 9: 36,549,176 (GRCm39) G28E probably benign Het
Pigf A T 17: 87,327,923 (GRCm39) F115I probably benign Het
Prpsap1 A T 11: 116,362,317 (GRCm39) V355E probably damaging Het
Ptprk G T 10: 28,359,294 (GRCm39) probably benign Het
Rae1 G A 2: 172,846,957 (GRCm39) R67H probably damaging Het
Sema3a G A 5: 13,606,494 (GRCm39) probably null Het
Slc22a22 T C 15: 57,126,758 (GRCm39) T104A probably benign Het
Slc38a2 A T 15: 96,593,168 (GRCm39) L137* probably null Het
Smgc A G 15: 91,725,670 (GRCm39) probably benign Het
Syce3 A G 15: 89,274,648 (GRCm39) probably benign Het
Syt9 T A 7: 107,024,343 (GRCm39) W79R probably damaging Het
Tgoln1 A C 6: 72,592,974 (GRCm39) S169A probably benign Het
Thnsl1 A G 2: 21,216,477 (GRCm39) D77G probably benign Het
Tsr1 T A 11: 74,798,767 (GRCm39) V712E probably damaging Het
Wdr12 C T 1: 60,128,525 (GRCm39) probably benign Het
Zfp3 T A 11: 70,662,395 (GRCm39) L118Q probably benign Het
Zfp592 A G 7: 80,687,623 (GRCm39) N883D probably benign Het
Zfp609 T A 9: 65,638,483 (GRCm39) M250L probably benign Het
Zfp94 A T 7: 24,002,495 (GRCm39) S316T probably damaging Het
Zfp955b A G 17: 33,521,947 (GRCm39) N472S probably benign Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 74,230,101 (GRCm39) missense possibly damaging 0.58
IGL00556:Xdh APN 17 74,191,430 (GRCm39) makesense probably null
IGL01524:Xdh APN 17 74,230,132 (GRCm39) critical splice acceptor site probably null
IGL01604:Xdh APN 17 74,216,332 (GRCm39) missense probably benign 0.02
IGL01625:Xdh APN 17 74,223,781 (GRCm39) critical splice donor site probably null
IGL01778:Xdh APN 17 74,207,275 (GRCm39) missense probably benign 0.00
IGL01804:Xdh APN 17 74,199,754 (GRCm39) missense probably damaging 1.00
IGL01825:Xdh APN 17 74,198,240 (GRCm39) missense probably damaging 1.00
IGL01929:Xdh APN 17 74,241,850 (GRCm39) missense probably damaging 1.00
IGL02068:Xdh APN 17 74,220,945 (GRCm39) missense probably damaging 1.00
IGL02079:Xdh APN 17 74,198,272 (GRCm39) missense probably damaging 1.00
IGL02210:Xdh APN 17 74,250,890 (GRCm39) missense probably benign 0.00
IGL02261:Xdh APN 17 74,220,960 (GRCm39) missense possibly damaging 0.81
IGL02365:Xdh APN 17 74,250,885 (GRCm39) missense probably benign 0.14
IGL02424:Xdh APN 17 74,233,565 (GRCm39) missense probably benign 0.00
IGL02491:Xdh APN 17 74,193,459 (GRCm39) missense probably damaging 0.99
IGL02525:Xdh APN 17 74,231,990 (GRCm39) missense possibly damaging 0.91
IGL02578:Xdh APN 17 74,213,241 (GRCm39) missense probably damaging 1.00
IGL02793:Xdh APN 17 74,207,576 (GRCm39) missense probably damaging 1.00
IGL02939:Xdh APN 17 74,250,840 (GRCm39) critical splice donor site probably null
IGL03327:Xdh APN 17 74,223,787 (GRCm39) missense probably benign
IGL03345:Xdh APN 17 74,213,027 (GRCm39) missense probably damaging 0.98
IGL03353:Xdh APN 17 74,202,781 (GRCm39) missense possibly damaging 0.65
inky UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
nucleus UTSW 17 74,206,007 (GRCm39) nonsense probably null
squidgame UTSW 17 74,246,831 (GRCm39) missense probably benign
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0033:Xdh UTSW 17 74,214,627 (GRCm39) missense probably benign 0.06
R0079:Xdh UTSW 17 74,198,213 (GRCm39) missense probably damaging 1.00
R0086:Xdh UTSW 17 74,191,433 (GRCm39) missense probably benign
R0319:Xdh UTSW 17 74,213,096 (GRCm39) splice site probably benign
R0336:Xdh UTSW 17 74,229,458 (GRCm39) missense possibly damaging 0.91
R0389:Xdh UTSW 17 74,205,357 (GRCm39) missense probably damaging 1.00
R0930:Xdh UTSW 17 74,230,077 (GRCm39) missense probably benign 0.00
R1073:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R1114:Xdh UTSW 17 74,248,144 (GRCm39) splice site probably benign
R1201:Xdh UTSW 17 74,225,413 (GRCm39) missense probably benign 0.05
R1230:Xdh UTSW 17 74,198,251 (GRCm39) missense probably damaging 1.00
R1351:Xdh UTSW 17 74,230,073 (GRCm39) missense probably benign 0.02
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1485:Xdh UTSW 17 74,221,014 (GRCm39) nonsense probably null
R1548:Xdh UTSW 17 74,220,896 (GRCm39) missense probably damaging 0.98
R1637:Xdh UTSW 17 74,207,573 (GRCm39) missense probably benign
R1641:Xdh UTSW 17 74,233,547 (GRCm39) missense probably benign
R1758:Xdh UTSW 17 74,217,204 (GRCm39) missense probably damaging 1.00
R1951:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R1969:Xdh UTSW 17 74,199,746 (GRCm39) missense possibly damaging 0.55
R2024:Xdh UTSW 17 74,228,300 (GRCm39) missense possibly damaging 0.92
R2080:Xdh UTSW 17 74,216,320 (GRCm39) missense probably damaging 1.00
R2157:Xdh UTSW 17 74,229,532 (GRCm39) missense probably damaging 1.00
R2300:Xdh UTSW 17 74,198,260 (GRCm39) missense probably damaging 1.00
R3783:Xdh UTSW 17 74,200,590 (GRCm39) splice site probably benign
R3796:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3797:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3798:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3799:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3819:Xdh UTSW 17 74,213,720 (GRCm39) missense probably benign 0.35
R4085:Xdh UTSW 17 74,223,874 (GRCm39) missense probably benign 0.35
R4240:Xdh UTSW 17 74,202,790 (GRCm39) missense possibly damaging 0.72
R4356:Xdh UTSW 17 74,222,685 (GRCm39) missense probably benign 0.01
R4522:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4523:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4524:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4600:Xdh UTSW 17 74,217,195 (GRCm39) missense probably benign 0.19
R4617:Xdh UTSW 17 74,225,389 (GRCm39) missense probably damaging 0.99
R4756:Xdh UTSW 17 74,193,381 (GRCm39) missense probably benign 0.24
R4761:Xdh UTSW 17 74,217,262 (GRCm39) missense possibly damaging 0.91
R4815:Xdh UTSW 17 74,213,210 (GRCm39) missense probably damaging 1.00
R4850:Xdh UTSW 17 74,205,330 (GRCm39) missense probably damaging 1.00
R4896:Xdh UTSW 17 74,217,238 (GRCm39) missense probably damaging 0.96
R4897:Xdh UTSW 17 74,207,703 (GRCm39) missense probably benign
R4923:Xdh UTSW 17 74,231,931 (GRCm39) missense possibly damaging 0.72
R4977:Xdh UTSW 17 74,205,965 (GRCm39) missense probably benign 0.05
R5030:Xdh UTSW 17 74,198,288 (GRCm39) missense probably damaging 1.00
R5185:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R5347:Xdh UTSW 17 74,232,027 (GRCm39) missense probably benign
R5556:Xdh UTSW 17 74,204,759 (GRCm39) missense probably benign 0.21
R5566:Xdh UTSW 17 74,200,617 (GRCm39) missense probably damaging 1.00
R5568:Xdh UTSW 17 74,250,880 (GRCm39) missense possibly damaging 0.90
R5635:Xdh UTSW 17 74,220,870 (GRCm39) missense possibly damaging 0.92
R5662:Xdh UTSW 17 74,248,110 (GRCm39) missense probably damaging 0.99
R5955:Xdh UTSW 17 74,205,315 (GRCm39) missense probably damaging 1.00
R6058:Xdh UTSW 17 74,213,264 (GRCm39) missense probably damaging 1.00
R6061:Xdh UTSW 17 74,228,342 (GRCm39) missense probably damaging 1.00
R6412:Xdh UTSW 17 74,242,902 (GRCm39) missense probably benign 0.09
R6526:Xdh UTSW 17 74,207,546 (GRCm39) missense probably damaging 0.97
R6558:Xdh UTSW 17 74,200,708 (GRCm39) missense possibly damaging 0.95
R6843:Xdh UTSW 17 74,230,125 (GRCm39) missense probably damaging 1.00
R6932:Xdh UTSW 17 74,229,557 (GRCm39) missense probably damaging 0.99
R7028:Xdh UTSW 17 74,250,868 (GRCm39) missense probably damaging 0.99
R7418:Xdh UTSW 17 74,220,960 (GRCm39) missense possibly damaging 0.81
R7503:Xdh UTSW 17 74,233,205 (GRCm39) missense probably damaging 1.00
R7653:Xdh UTSW 17 74,204,040 (GRCm39) missense probably benign 0.10
R7763:Xdh UTSW 17 74,241,829 (GRCm39) missense possibly damaging 0.69
R7768:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R7904:Xdh UTSW 17 74,229,467 (GRCm39) missense probably benign 0.09
R8010:Xdh UTSW 17 74,216,312 (GRCm39) nonsense probably null
R8067:Xdh UTSW 17 74,207,652 (GRCm39) missense probably benign 0.01
R8238:Xdh UTSW 17 74,193,412 (GRCm39) missense probably benign
R8253:Xdh UTSW 17 74,225,377 (GRCm39) missense possibly damaging 0.94
R8346:Xdh UTSW 17 74,220,938 (GRCm39) missense probably damaging 1.00
R8350:Xdh UTSW 17 74,241,837 (GRCm39) missense probably damaging 1.00
R8381:Xdh UTSW 17 74,219,456 (GRCm39) missense probably benign
R8427:Xdh UTSW 17 74,242,926 (GRCm39) missense probably damaging 1.00
R8465:Xdh UTSW 17 74,206,007 (GRCm39) nonsense probably null
R8478:Xdh UTSW 17 74,213,053 (GRCm39) missense probably benign 0.00
R8680:Xdh UTSW 17 74,229,500 (GRCm39) missense probably benign
R8802:Xdh UTSW 17 74,225,405 (GRCm39) missense probably benign 0.00
R8984:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8985:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8995:Xdh UTSW 17 74,205,369 (GRCm39) missense probably damaging 1.00
R9035:Xdh UTSW 17 74,217,222 (GRCm39) missense probably benign
R9149:Xdh UTSW 17 74,222,688 (GRCm39) missense probably benign
R9181:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R9357:Xdh UTSW 17 74,233,541 (GRCm39) critical splice donor site probably null
R9357:Xdh UTSW 17 74,214,711 (GRCm39) missense probably damaging 0.97
R9609:Xdh UTSW 17 74,231,990 (GRCm39) missense possibly damaging 0.91
R9803:Xdh UTSW 17 74,229,455 (GRCm39) missense probably benign
X0019:Xdh UTSW 17 74,225,449 (GRCm39) missense probably damaging 1.00
Z1088:Xdh UTSW 17 74,193,423 (GRCm39) missense probably benign
Z1176:Xdh UTSW 17 74,230,037 (GRCm39) critical splice donor site probably null
Z1177:Xdh UTSW 17 74,204,690 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAGAGAGGTTCCTGGGTAATC -3'
(R):5'- TAGACCCCAAGCTTCTGTGGTGTG -3'

Sequencing Primer
(F):5'- TGAACAGCCTCTCATTTGAGGAC -3'
(R):5'- TCTAGGACCCGAGGGCAC -3'
Posted On 2014-08-18