Mutagenetix > Incidental Mutations

Incidental Mutation 'R0827:Hsp90aa1'

218654

Institutional Source

Beutler Lab

Gene Symbol

Hsp90aa1

Ensembl Gene

ENSMUSG00000021270

Gene Name

heat shock protein 90, alpha (cytosolic), class A member 1

Synonyms

hsp4, Hspca, Hsp90, Hsp86-1, Hsp89

MMRRC Submission

039007-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0827 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

110690605-110702728 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 110692695 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 556 (E556G)

Ref Sequence

ENSEMBL: ENSMUSP00000091921 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021698] [ENSMUST00000094361] [ENSMUST00000124156] [ENSMUST00000149189] [ENSMUST00000155242]

Predicted Effect

probably benign
Transcript: ENSMUST00000021698
AA Change: E556G

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000021698
Gene: ENSMUSG00000021270
AA Change: E556G

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART
Pfam:HSP90	196	733	6.7e-272	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000094361
AA Change: E556G

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000091921
Gene: ENSMUSG00000021270
AA Change: E556G

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART
Pfam:HSP90	196	728	2e-245	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000124156

SMART Domains

Protein: ENSMUSP00000121138
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
PDB:3HHU\|B	1	103	1e-69	PDB
SCOP:d1byqa_	11	103	5e-48	SMART
Blast:HATPase_c	40	103	7e-39	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129005

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134967

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145255

Predicted Effect

probably benign
Transcript: ENSMUST00000149189

SMART Domains

Protein: ENSMUSP00000114201
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
PDB:3HHU\|B	1	98	6e-66	PDB
SCOP:d1byqa_	11	98	2e-45	SMART
Blast:HATPase_c	40	98	2e-35	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000155242

SMART Domains

Protein: ENSMUSP00000118189
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART

Meta Mutation Damage Score

0.4030

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 93.6%

Validation Efficiency

100% (88/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inducible molecular chaperone that functions as a homodimer. The encoded protein aids in the proper folding of specific target proteins by use of an ATPase activity that is modulated by co-chaperones. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male sterility associated with arrested male meiosis and male germ cell apoptosis. Mice homozygous for a transgenic gene disruption exhibit male sterility and small testis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	T	C	7: 79,099,671	S1397P	probably benign	Het
Adamts15	T	C	9: 30,921,480	Y253C	probably damaging	Het
Ankk1	A	G	9: 49,421,737	I149T	possibly damaging	Het
Ankrd63	A	G	2: 118,702,553	S296P	possibly damaging	Het
Arpc1b	T	G	5: 145,125,756	C227G	probably benign	Het
B4gat1	A	G	19: 5,039,697	R241G	possibly damaging	Het
Ccar2	T	C	14: 70,139,838	N751D	probably benign	Het
Cd55b	T	C	1: 130,414,236	I221M	probably damaging	Het
Cntn5	A	G	9: 9,666,938	V1032A	possibly damaging	Het
Col11a1	G	A	3: 114,138,765	R113H	unknown	Het
Colec10	G	A	15: 54,462,584	C270Y	probably damaging	Het
Ctnnbl1	C	T	2: 157,799,417		probably benign	Het
Cyp2j12	T	G	4: 96,112,862		probably benign	Het
Dennd5a	G	A	7: 109,899,731	T999M	probably damaging	Het
Dusp13	C	A	14: 21,742,771	V29L	probably benign	Het
Efr3a	A	C	15: 65,853,551	D83A	possibly damaging	Het
Elmod2	A	G	8: 83,316,795		probably null	Het
Eml3	C	A	19: 8,938,466	T640K	probably damaging	Het
Eps8l1	T	C	7: 4,477,389	V543A	possibly damaging	Het
Ermn	T	C	2: 58,048,251	K117E	probably damaging	Het
F830045P16Rik	A	G	2: 129,472,776	S194P	probably benign	Het
Faim2	A	G	15: 99,524,736	V60A	probably benign	Het
Fancd2	G	A	6: 113,586,249		probably null	Het
Fbxo43	A	T	15: 36,162,969	S31T	possibly damaging	Het
Gab2	G	A	7: 97,300,332	R411Q	probably damaging	Het
Gm17727	A	T	9: 35,777,851	L12Q	probably damaging	Het
Gpm6a	A	T	8: 55,058,883	D264V	probably damaging	Het
Hist1h1t	A	G	13: 23,696,221	D119G	probably benign	Het
Ifi203	A	T	1: 173,928,463		probably benign	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Kcnc3	A	G	7: 44,595,206	T307A	probably damaging	Het
Kin	C	A	2: 10,090,376		probably benign	Het
Knl1	T	C	2: 119,088,901		probably benign	Het
Lrp4	G	A	2: 91,495,041	V1404M	probably damaging	Het
Lrrc71	T	A	3: 87,742,645		probably null	Het
Med13l	T	C	5: 118,726,247		probably benign	Het
Mfap5	A	G	6: 122,520,920	D39G	probably damaging	Het
Mlxipl	T	C	5: 135,132,738	S504P	probably benign	Het
Myo3a	T	G	2: 22,558,215	Y1D	probably damaging	Het
Nek1	A	G	8: 61,105,648		probably benign	Het
Nfkbiz	T	C	16: 55,816,367	R524G	probably damaging	Het
Npbwr1	T	C	1: 5,916,789	T169A	possibly damaging	Het
Nuggc	T	C	14: 65,608,891	Y84H	probably damaging	Het
Nxph3	G	A	11: 95,511,426	S54L	probably benign	Het
Olfr311	T	C	11: 58,841,771	I219T	probably damaging	Het
Olfr532	A	G	7: 140,419,467	F102S	probably damaging	Het
Ostn	A	G	16: 27,324,631	N70D	probably damaging	Het
Pcdhb2	G	A	18: 37,295,657	V228I	possibly damaging	Het
Pnpla6	A	T	8: 3,517,618	M109L	possibly damaging	Het
Ppil6	T	A	10: 41,494,504		probably benign	Het
Prss46	A	G	9: 110,851,432	N215S	probably benign	Het
Ptprd	A	T	4: 76,128,915	D371E	probably damaging	Het
Ripor2	T	A	13: 24,694,186	F315I	probably damaging	Het
Rmi2	G	A	16: 10,835,240	G51S	probably damaging	Het
Scg3	A	G	9: 75,683,697	I10T	possibly damaging	Het
Scn9a	T	A	2: 66,536,124	K761*	probably null	Het
Scyl2	A	G	10: 89,657,865	L347P	possibly damaging	Het
Sh3d21	A	G	4: 126,152,271		probably benign	Het
Shc1	T	A	3: 89,426,783		probably null	Het
Slbp	A	G	5: 33,643,822	S182P	probably damaging	Het
Slc24a1	C	T	9: 64,928,190	G885D	probably benign	Het
Slc24a3	T	C	2: 145,518,492		probably benign	Het
Sowahb	T	G	5: 93,043,286	N525H	probably damaging	Het
Sppl3	T	A	5: 115,082,333	C101*	probably null	Het
Srsf5	A	G	12: 80,949,540	K163E	probably damaging	Het
Sult2a4	A	G	7: 13,984,961	I119T	probably benign	Het
Svep1	A	G	4: 58,053,113		probably benign	Het
Tas1r3	G	A	4: 155,860,869	R632W	probably benign	Het
Tlr4	T	A	4: 66,833,880		probably null	Het
Tmf1	A	C	6: 97,158,050	L1001*	probably null	Het
Tnnt2	A	G	1: 135,843,796		probably benign	Het
Trank1	G	A	9: 111,349,417		probably benign	Het
Trdn	A	T	10: 33,399,158		probably benign	Het
Trmt6	A	T	2: 132,815,834	V34E	probably damaging	Het
Trrap	T	C	5: 144,814,830	F1699L	probably benign	Het
Ttk	A	G	9: 83,843,915	R250G	probably benign	Het
Ttn	T	A	2: 76,809,904	I13787F	probably damaging	Het
Uggt1	T	A	1: 36,156,313		probably null	Het
Ugt2b35	T	A	5: 87,008,130		probably benign	Het
Ugt2b36	C	A	5: 87,066,375	R470L	possibly damaging	Het
Unk	A	G	11: 116,053,109	D352G	possibly damaging	Het
Vmn2r77	G	T	7: 86,802,016	C370F	probably damaging	Het
Vmn2r85	A	G	10: 130,429,518	I32T	possibly damaging	Het
Zfp637	A	G	6: 117,845,444	I178V	possibly damaging	Het
Zfp943	A	G	17: 21,992,090		probably null	Het
Zyg11a	A	G	4: 108,210,042		probably benign	Het

Other mutations in Hsp90aa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02056:Hsp90aa1	APN	12	110694015	unclassified	probably benign
IGL02243:Hsp90aa1	APN	12	110695091	missense	probably damaging	1.00
IGL02865:Hsp90aa1	APN	12	110693082	missense	probably benign	0.11
IGL02965:Hsp90aa1	APN	12	110695679	start codon destroyed	probably null	0.95
R1331:Hsp90aa1	UTSW	12	110692820	missense	probably damaging	1.00
R1498:Hsp90aa1	UTSW	12	110695688	splice site	probably null
R2039:Hsp90aa1	UTSW	12	110693782	missense	probably damaging	1.00
R2082:Hsp90aa1	UTSW	12	110692827	missense	probably damaging	1.00
R2102:Hsp90aa1	UTSW	12	110694132	missense	probably damaging	0.99
R2169:Hsp90aa1	UTSW	12	110692734	missense	probably damaging	0.99
R2194:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2194:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2359:Hsp90aa1	UTSW	12	110694569	critical splice donor site	probably null
R2364:Hsp90aa1	UTSW	12	110692753	missense	probably damaging	0.99
R2393:Hsp90aa1	UTSW	12	110693406	missense	probably damaging	1.00
R2398:Hsp90aa1	UTSW	12	110692321	missense	possibly damaging	0.86
R2435:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2435:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2924:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2924:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2925:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2925:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3176:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3176:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3177:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3177:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3276:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3276:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3277:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3277:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3615:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3615:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3616:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3616:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R4033:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R4033:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R4815:Hsp90aa1	UTSW	12	110695226	missense	possibly damaging	0.45
R4932:Hsp90aa1	UTSW	12	110693717	missense	probably damaging	1.00
R5117:Hsp90aa1	UTSW	12	110695264	missense	possibly damaging	0.71
R5555:Hsp90aa1	UTSW	12	110692734	missense	probably damaging	1.00
R6382:Hsp90aa1	UTSW	12	110695517	critical splice donor site	probably null
R7024:Hsp90aa1	UTSW	12	110694112	missense	possibly damaging	0.46
R7324:Hsp90aa1	UTSW	12	110695225	missense	unknown
R7447:Hsp90aa1	UTSW	12	110692128	missense	possibly damaging	0.94
R7526:Hsp90aa1	UTSW	12	110695294	missense	unknown
R7732:Hsp90aa1	UTSW	12	110693418	missense	probably damaging	1.00
R8155:Hsp90aa1	UTSW	12	110695394	missense	unknown
Z1177:Hsp90aa1	UTSW	12	110693466	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATACAGCACGGGGATGTCACCAG -3'
(R):5'- GACCAAGGACCAGGTTGCTAACTC -3'

Sequencing Primer
(F):5'- GTCACCAGTCGGTTTGACAC -3'
(R):5'- AACTCCGCCTTTGTGGAAC -3'

Posted On

2014-08-18