Incidental Mutation 'R0657:Bfsp1'
ID 218663
Institutional Source Beutler Lab
Gene Symbol Bfsp1
Ensembl Gene ENSMUSG00000027420
Gene Name beaded filament structural protein 1, in lens-CP94
Synonyms filensin
MMRRC Submission 038842-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.152) question?
Stock # R0657 (G1)
Quality Score 35
Status Validated
Chromosome 2
Chromosomal Location 143668448-143705093 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to C at 143669570 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028907] [ENSMUST00000099296]
AlphaFold A2AMT1
Predicted Effect probably benign
Transcript: ENSMUST00000028907
SMART Domains Protein: ENSMUSP00000028907
Gene: ENSMUSG00000027420

DomainStartEndE-ValueType
Pfam:Filament 34 205 2.5e-13 PFAM
low complexity region 400 411 N/A INTRINSIC
low complexity region 544 561 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099296
SMART Domains Protein: ENSMUSP00000096899
Gene: ENSMUSG00000027420

DomainStartEndE-ValueType
Filament 32 317 1.05e-6 SMART
low complexity region 406 417 N/A INTRINSIC
low complexity region 550 567 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 91.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lens-specific intermediate filament-like protein named filensin. The encoded protein is expressed in lens fiber cells after differentiation has begun. This protein functions as a component of the beaded filament which is a cytoskeletal structure found in lens fiber cells. Mutations in this gene are the cause of autosomal recessive cortical juvenile-onset cataract. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mutations in this gene produce lens abnormalities progressing to cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G A 18: 70,602,553 (GRCm39) Q87* probably null Het
Aldh7a1 C T 18: 56,670,269 (GRCm39) probably benign Het
Btbd10 A T 7: 112,929,085 (GRCm39) S230T possibly damaging Het
Chd7 T C 4: 8,753,141 (GRCm39) V546A probably damaging Het
Defb13 T C 8: 22,436,877 (GRCm39) probably benign Het
F13a1 A T 13: 37,152,079 (GRCm39) D237E probably damaging Het
F8 T C X: 74,255,022 (GRCm39) Q2124R possibly damaging Het
Hivep2 T C 10: 14,007,622 (GRCm39) S1407P probably benign Het
Hmgcs2 A G 3: 98,198,369 (GRCm39) T91A probably benign Het
Huwe1 T C X: 150,702,924 (GRCm39) I3463T probably benign Het
Iars1 T C 13: 49,855,995 (GRCm39) Y289H probably damaging Het
Ints8 C A 4: 11,246,097 (GRCm39) V190L probably benign Het
Itgb1 T G 8: 129,449,335 (GRCm39) Y585D possibly damaging Het
Kif14 C T 1: 136,396,840 (GRCm39) T382I probably benign Het
Lypd10 T A 7: 24,412,872 (GRCm39) D93E probably benign Het
Me2 A G 18: 73,903,744 (GRCm39) S575P probably benign Het
Mgat4b T C 11: 50,121,908 (GRCm39) V143A possibly damaging Het
Mroh2a C A 1: 88,183,287 (GRCm39) L1292I probably damaging Het
Nek8 C T 11: 78,062,033 (GRCm39) S237N probably benign Het
Neto1 G A 18: 86,479,445 (GRCm39) R211Q probably benign Het
Nfatc2ip A G 7: 125,990,507 (GRCm39) S165P probably benign Het
Or1e34 T C 11: 73,778,611 (GRCm39) M196V probably benign Het
Or1e34 C T 11: 73,778,656 (GRCm39) V181I probably benign Het
Patj C A 4: 98,555,885 (GRCm39) Q297K probably damaging Het
Pde5a A G 3: 122,542,107 (GRCm39) N199S probably damaging Het
Pip4k2b A T 11: 97,613,762 (GRCm39) probably benign Het
Ptch1 A G 13: 63,661,565 (GRCm39) V1054A possibly damaging Het
Slc17a5 G A 9: 78,485,956 (GRCm39) A43V probably damaging Het
Spata20 T A 11: 94,371,435 (GRCm39) D643V probably damaging Het
Tars2 A T 3: 95,655,869 (GRCm39) V289E probably benign Het
Tmem135 A T 7: 88,793,890 (GRCm39) I384N probably damaging Het
Trip12 C T 1: 84,736,771 (GRCm39) M816I probably benign Het
Ulk2 T C 11: 61,698,880 (GRCm39) probably benign Het
Zzef1 T C 11: 72,712,677 (GRCm39) V199A probably benign Het
Other mutations in Bfsp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Bfsp1 APN 2 143,673,812 (GRCm39) missense probably damaging 1.00
IGL01457:Bfsp1 APN 2 143,669,564 (GRCm39) splice site probably benign
IGL02329:Bfsp1 APN 2 143,704,566 (GRCm39) missense probably benign
IGL02354:Bfsp1 APN 2 143,673,907 (GRCm39) missense probably damaging 1.00
IGL02361:Bfsp1 APN 2 143,673,907 (GRCm39) missense probably damaging 1.00
IGL02365:Bfsp1 APN 2 143,668,656 (GRCm39) missense probably damaging 1.00
IGL02407:Bfsp1 APN 2 143,668,853 (GRCm39) missense probably benign 0.00
IGL03118:Bfsp1 APN 2 143,669,253 (GRCm39) missense possibly damaging 0.94
I0000:Bfsp1 UTSW 2 143,687,888 (GRCm39) missense probably damaging 1.00
R0112:Bfsp1 UTSW 2 143,669,563 (GRCm39) splice site probably null
R1642:Bfsp1 UTSW 2 143,683,683 (GRCm39) missense probably damaging 1.00
R1816:Bfsp1 UTSW 2 143,683,599 (GRCm39) missense probably benign 0.23
R2061:Bfsp1 UTSW 2 143,704,598 (GRCm39) missense probably benign 0.08
R2248:Bfsp1 UTSW 2 143,669,572 (GRCm39) splice site probably null
R3024:Bfsp1 UTSW 2 143,687,879 (GRCm39) missense probably benign 0.19
R4029:Bfsp1 UTSW 2 143,673,749 (GRCm39) splice site probably benign
R4914:Bfsp1 UTSW 2 143,669,391 (GRCm39) missense probably benign 0.21
R4915:Bfsp1 UTSW 2 143,669,391 (GRCm39) missense probably benign 0.21
R4917:Bfsp1 UTSW 2 143,669,391 (GRCm39) missense probably benign 0.21
R4918:Bfsp1 UTSW 2 143,669,391 (GRCm39) missense probably benign 0.21
R5018:Bfsp1 UTSW 2 143,704,802 (GRCm39) missense possibly damaging 0.81
R5202:Bfsp1 UTSW 2 143,668,891 (GRCm39) missense probably benign
R5267:Bfsp1 UTSW 2 143,668,971 (GRCm39) missense probably benign 0.03
R5304:Bfsp1 UTSW 2 143,669,211 (GRCm39) missense probably benign 0.34
R5825:Bfsp1 UTSW 2 143,669,379 (GRCm39) missense probably benign 0.01
R6465:Bfsp1 UTSW 2 143,699,975 (GRCm39) critical splice donor site probably null
R6888:Bfsp1 UTSW 2 143,668,639 (GRCm39) missense probably benign 0.31
R7036:Bfsp1 UTSW 2 143,668,843 (GRCm39) missense possibly damaging 0.65
R7075:Bfsp1 UTSW 2 143,690,885 (GRCm39) missense probably damaging 1.00
R7362:Bfsp1 UTSW 2 143,668,795 (GRCm39) missense probably benign 0.19
R7538:Bfsp1 UTSW 2 143,673,755 (GRCm39) critical splice donor site probably null
R7839:Bfsp1 UTSW 2 143,673,770 (GRCm39) missense possibly damaging 0.79
X0022:Bfsp1 UTSW 2 143,700,037 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACTTTGCACAGTTTCCCAAAGGC -3'
(R):5'- TGACTCACGCACAGTTTCTCAGG -3'

Sequencing Primer
(F):5'- TCTGGCACATCCTCAGGAC -3'
(R):5'- GCACAGTTTCTCAGGTGGTC -3'
Posted On 2014-08-19