Incidental Mutation 'R0657:Bfsp1'
ID218663
Institutional Source Beutler Lab
Gene Symbol Bfsp1
Ensembl Gene ENSMUSG00000027420
Gene Namebeaded filament structural protein 1, in lens-CP94
Synonymsfilensin
MMRRC Submission 038842-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R0657 (G1)
Quality Score35
Status Validated
Chromosome2
Chromosomal Location143826528-143863173 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 143827650 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028907] [ENSMUST00000099296]
Predicted Effect probably benign
Transcript: ENSMUST00000028907
SMART Domains Protein: ENSMUSP00000028907
Gene: ENSMUSG00000027420

DomainStartEndE-ValueType
Pfam:Filament 34 205 2.5e-13 PFAM
low complexity region 400 411 N/A INTRINSIC
low complexity region 544 561 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099296
SMART Domains Protein: ENSMUSP00000096899
Gene: ENSMUSG00000027420

DomainStartEndE-ValueType
Filament 32 317 1.05e-6 SMART
low complexity region 406 417 N/A INTRINSIC
low complexity region 550 567 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 91.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lens-specific intermediate filament-like protein named filensin. The encoded protein is expressed in lens fiber cells after differentiation has begun. This protein functions as a component of the beaded filament which is a cytoskeletal structure found in lens fiber cells. Mutations in this gene are the cause of autosomal recessive cortical juvenile-onset cataract. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mutations in this gene produce lens abnormalities progressing to cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G A 18: 70,469,482 Q87* probably null Het
Aldh7a1 C T 18: 56,537,197 probably benign Het
BC049730 T A 7: 24,713,447 D93E probably benign Het
Btbd10 A T 7: 113,329,878 S230T possibly damaging Het
Chd7 T C 4: 8,753,141 V546A probably damaging Het
Defb13 T C 8: 21,946,861 probably benign Het
F13a1 A T 13: 36,968,105 D237E probably damaging Het
F8 T C X: 75,211,416 Q2124R possibly damaging Het
Hivep2 T C 10: 14,131,878 S1407P probably benign Het
Hmgcs2 A G 3: 98,291,053 T91A probably benign Het
Huwe1 T C X: 151,919,928 I3463T probably benign Het
Iars T C 13: 49,702,519 Y289H probably damaging Het
Ints8 C A 4: 11,246,097 V190L probably benign Het
Itgb1 T G 8: 128,722,854 Y585D possibly damaging Het
Kif14 C T 1: 136,469,102 T382I probably benign Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Mgat4b T C 11: 50,231,081 V143A possibly damaging Het
Mroh2a C A 1: 88,255,565 L1292I probably damaging Het
Nek8 C T 11: 78,171,207 S237N probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nfatc2ip A G 7: 126,391,335 S165P probably benign Het
Olfr394 T C 11: 73,887,785 M196V probably benign Het
Olfr394 C T 11: 73,887,830 V181I probably benign Het
Patj C A 4: 98,667,648 Q297K probably damaging Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Pip4k2b A T 11: 97,722,936 probably benign Het
Ptch1 A G 13: 63,513,751 V1054A possibly damaging Het
Slc17a5 G A 9: 78,578,674 A43V probably damaging Het
Spata20 T A 11: 94,480,609 D643V probably damaging Het
Tars2 A T 3: 95,748,557 V289E probably benign Het
Tmem135 A T 7: 89,144,682 I384N probably damaging Het
Trip12 C T 1: 84,759,050 M816I probably benign Het
Ulk2 T C 11: 61,808,054 probably benign Het
Zzef1 T C 11: 72,821,851 V199A probably benign Het
Other mutations in Bfsp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Bfsp1 APN 2 143831892 missense probably damaging 1.00
IGL01457:Bfsp1 APN 2 143827644 splice site probably benign
IGL02329:Bfsp1 APN 2 143862646 missense probably benign
IGL02354:Bfsp1 APN 2 143831987 missense probably damaging 1.00
IGL02361:Bfsp1 APN 2 143831987 missense probably damaging 1.00
IGL02365:Bfsp1 APN 2 143826736 missense probably damaging 1.00
IGL02407:Bfsp1 APN 2 143826933 missense probably benign 0.00
IGL03118:Bfsp1 APN 2 143827333 missense possibly damaging 0.94
I0000:Bfsp1 UTSW 2 143845968 missense probably damaging 1.00
R0112:Bfsp1 UTSW 2 143827643 splice site probably null
R1642:Bfsp1 UTSW 2 143841763 missense probably damaging 1.00
R1816:Bfsp1 UTSW 2 143841679 missense probably benign 0.23
R2061:Bfsp1 UTSW 2 143862678 missense probably benign 0.08
R2248:Bfsp1 UTSW 2 143827652 splice site probably null
R3024:Bfsp1 UTSW 2 143845959 missense probably benign 0.19
R4029:Bfsp1 UTSW 2 143831829 splice site probably benign
R4914:Bfsp1 UTSW 2 143827471 missense probably benign 0.21
R4915:Bfsp1 UTSW 2 143827471 missense probably benign 0.21
R4917:Bfsp1 UTSW 2 143827471 missense probably benign 0.21
R4918:Bfsp1 UTSW 2 143827471 missense probably benign 0.21
R5018:Bfsp1 UTSW 2 143862882 missense possibly damaging 0.81
R5202:Bfsp1 UTSW 2 143826971 missense probably benign
R5267:Bfsp1 UTSW 2 143827051 missense probably benign 0.03
R5304:Bfsp1 UTSW 2 143827291 missense probably benign 0.34
R5825:Bfsp1 UTSW 2 143827459 missense probably benign 0.01
R6465:Bfsp1 UTSW 2 143858055 critical splice donor site probably null
R6888:Bfsp1 UTSW 2 143826719 missense probably benign 0.31
R7036:Bfsp1 UTSW 2 143826923 missense possibly damaging 0.65
R7075:Bfsp1 UTSW 2 143848965 missense probably damaging 1.00
R7362:Bfsp1 UTSW 2 143826875 missense probably benign 0.19
R7538:Bfsp1 UTSW 2 143831835 critical splice donor site probably null
R7839:Bfsp1 UTSW 2 143831850 missense possibly damaging 0.79
X0022:Bfsp1 UTSW 2 143858117 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACTTTGCACAGTTTCCCAAAGGC -3'
(R):5'- TGACTCACGCACAGTTTCTCAGG -3'

Sequencing Primer
(F):5'- TCTGGCACATCCTCAGGAC -3'
(R):5'- GCACAGTTTCTCAGGTGGTC -3'
Posted On2014-08-19