Mutagenetix > Incidental Mutations

Incidental Mutation 'R0723:Tet2'

218676

Institutional Source

Beutler Lab

Gene Symbol

Tet2

Ensembl Gene

ENSMUSG00000040943

Gene Name

tet methylcytosine dioxygenase 2

Synonyms

E130014J05Rik, Ayu17-449

MMRRC Submission

038905-MU

Accession Numbers

Ncbi RefSeq: NM_001040400.2; MGI:2443298

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0723 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

133463679-133545139 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 133467284 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1739 (E1739G)

Ref Sequence

ENSEMBL: ENSMUSP00000143029 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098603] [ENSMUST00000196398]

Predicted Effect

probably benign
Transcript: ENSMUST00000098603
AA Change: E1731G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000096203
Gene: ENSMUSG00000040943
AA Change: E1731G

Domain	Start	End	E-Value	Type
low complexity region	690	701	N/A	INTRINSIC
low complexity region	855	862	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	899	921	N/A	INTRINSIC
Tet_JBP	1203	1819	7e-301	SMART
low complexity region	1832	1844	N/A	INTRINSIC
low complexity region	1885	1897	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000196398
AA Change: E1739G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000143029
Gene: ENSMUSG00000040943
AA Change: E1739G

Domain	Start	End	E-Value	Type
low complexity region	690	701	N/A	INTRINSIC
low complexity region	855	862	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	899	921	N/A	INTRINSIC
Tet_JBP	1211	1827	3.4e-305	SMART
low complexity region	1840	1852	N/A	INTRINSIC
low complexity region	1893	1905	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197211

Predicted Effect

probably benign
Transcript: ENSMUST00000198974

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199381

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.7%
20x: 96.0%

Validation Efficiency

99% (69/70)

MGI Phenotype

Strain: 5285413; 4345275; 3813933; 5301343
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a methylcytosine dioxygenase that catalyzes the conversion of methylcytosine to 5-hydroxymethylcytosine. The encoded protein is involved in myelopoiesis, and defects in this gene have been associated with several myeloproliferative disorders. Two variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele die shortly after birth and exhibit a loss of acidic granules in the proximal convoluted tubules of the kidneys. Mice homozygous for a conditional allele activated in hematopoeitic compartment exhibit self-renewal and myeloid transforamtion. [provided by MGI curators]

Allele List at MGI

All alleles(1246) : Targeted(6) Gene trapped(1240)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	A	4: 42,971,691	N341K	probably damaging	Het
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
4931423N10Rik	T	C	2: 23,256,924		probably benign	Het
8030411F24Rik	T	C	2: 148,783,362	I72T	probably damaging	Het
Acbd5	T	G	2: 23,069,596	V54G	probably damaging	Het
Acin1	A	T	14: 54,665,451	S255T	probably damaging	Het
Adcy2	A	G	13: 68,999,129	L56P	probably damaging	Het
Akap6	G	T	12: 53,141,902	C2033F	probably damaging	Het
Ano5	A	G	7: 51,587,758	I777V	probably benign	Het
Arhgef28	A	G	13: 97,939,479	V1349A	probably benign	Het
Bank1	T	C	3: 136,054,403		probably null	Het
C2cd5	T	C	6: 143,041,555		probably benign	Het
Cadps2	A	G	6: 23,287,698	V1161A	probably damaging	Het
Car8	A	T	4: 8,169,703	D268E	probably benign	Het
Ckap5	T	A	2: 91,555,331	S175T	probably damaging	Het
Clk4	T	A	11: 51,275,493	Y67*	probably null	Het
Copg2	T	C	6: 30,815,982	I473V	possibly damaging	Het
Cyp2s1	C	T	7: 25,809,548	V43I	probably benign	Het
Ddx54	A	G	5: 120,623,638	D493G	probably benign	Het
Efemp2	T	C	19: 5,480,050	S140P	probably damaging	Het
Fam214a	G	A	9: 75,009,451	G444E	probably damaging	Het
Fat1	C	A	8: 45,026,749	T2944K	probably damaging	Het
Fgfr1	T	A	8: 25,557,768	D43E	probably damaging	Het
Fry	G	A	5: 150,496,360	A996T	probably damaging	Het
Fyb2	G	A	4: 105,015,866	V784I	probably benign	Het
Gm6507	T	A	6: 89,185,162		noncoding transcript	Het
Gm7964	T	C	7: 83,756,166		noncoding transcript	Het
Gucy2c	T	C	6: 136,727,801		probably null	Het
Hdac10	A	T	15: 89,126,418	L259Q	probably damaging	Het
Hoxd9	A	T	2: 74,698,828	D258V	probably damaging	Het
Hs3st3b1	T	C	11: 63,921,575	T105A	probably benign	Het
Hsd17b7	A	G	1: 169,956,026	L271P	probably damaging	Het
Ifnlr1	T	A	4: 135,701,213		probably benign	Het
Kif22	A	T	7: 127,033,906	M121K	probably damaging	Het
Kl	G	A	5: 150,953,101	D129N	probably damaging	Het
Mettl13	A	T	1: 162,534,430	I648N	probably damaging	Het
Mlh1	C	T	9: 111,271,472	R18H	probably damaging	Het
Mtmr14	T	C	6: 113,270,512		probably benign	Het
Myo15	C	A	11: 60,478,977	N854K	possibly damaging	Het
Myo1h	T	C	5: 114,319,680	I84T	probably benign	Het
Myo9a	A	T	9: 59,871,100	S1380C	probably benign	Het
Myof	A	G	19: 37,981,260	V318A	probably damaging	Het
N4bp2l2	A	G	5: 150,662,432	S28P	probably damaging	Het
Narfl	G	A	17: 25,781,821	V406M	probably damaging	Het
Nbr1	C	T	11: 101,576,319	Q570*	probably null	Het
Nhp2	C	T	11: 51,619,923	Q36*	probably null	Het
Olfr23	T	G	11: 73,940,270	V8G	probably benign	Het
Olfr884	G	T	9: 38,047,827	V202L	probably benign	Het
Poc1b	T	A	10: 99,129,595	W129R	probably damaging	Het
Rapgef2	C	T	3: 79,079,174	E1018K	probably benign	Het
Rgs12	T	C	5: 35,024,366		probably benign	Het
Rufy2	G	A	10: 62,998,094	V280I	probably benign	Het
Snx2	A	G	18: 53,210,372	I281V	probably benign	Het
Spag5	C	A	11: 78,319,584		probably benign	Het
Stxbp5	A	T	10: 9,768,873	I961N	probably damaging	Het
Tmod2	A	G	9: 75,595,055	F50S	possibly damaging	Het
Tnfsf13b	T	G	8: 10,007,166		probably null	Het
Ttn	T	C	2: 76,786,335	K16525E	possibly damaging	Het
Txnrd2	T	C	16: 18,440,879		probably benign	Het
Ubr1	A	T	2: 120,881,101	Y1437*	probably null	Het
Vwf	C	A	6: 125,566,262	D170E	probably benign	Het
Wdr95	C	G	5: 149,574,048	I230M	probably damaging	Het
Xirp2	C	T	2: 67,512,215	S1600F	probably damaging	Het
Zfp12	A	G	5: 143,244,883	K322E	probably damaging	Het

Other mutations in Tet2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Tet2	APN	3	133488085	missense	possibly damaging	0.96
IGL00401:Tet2	APN	3	133466882	missense	possibly damaging	0.72
IGL01528:Tet2	APN	3	133480298	missense	possibly damaging	0.86
IGL02053:Tet2	APN	3	133488523	missense	possibly damaging	0.96
IGL02142:Tet2	APN	3	133480139	missense	possibly damaging	0.96
IGL02512:Tet2	APN	3	133469308	missense	probably benign	0.05
IGL03148:Tet2	APN	3	133481363	missense	probably benign	0.18
IGL03182:Tet2	APN	3	133471398	nonsense	probably null
IGL03371:Tet2	APN	3	133467551	missense	possibly damaging	0.71
P0022:Tet2	UTSW	3	133486893	missense	probably benign	0.01
P0023:Tet2	UTSW	3	133486893	missense	probably benign	0.01
P0031:Tet2	UTSW	3	133480202	missense	possibly damaging	0.53
R0012:Tet2	UTSW	3	133476558	missense	probably damaging	0.98
R0012:Tet2	UTSW	3	133476558	missense	probably damaging	0.98
R0463:Tet2	UTSW	3	133486666	missense	possibly damaging	0.86
R0522:Tet2	UTSW	3	133466804	missense	probably damaging	0.98
R0593:Tet2	UTSW	3	133488109	missense	probably benign	0.00
R0600:Tet2	UTSW	3	133467602	missense	probably benign	0.00
R0600:Tet2	UTSW	3	133467725	missense	probably benign	0.01
R0698:Tet2	UTSW	3	133467384	missense	probably benign	0.32
R0726:Tet2	UTSW	3	133468184	missense	probably benign
R0747:Tet2	UTSW	3	133467470	missense	possibly damaging	0.86
R1006:Tet2	UTSW	3	133476601	missense	possibly damaging	0.53
R1382:Tet2	UTSW	3	133476615	missense	probably damaging	1.00
R1455:Tet2	UTSW	3	133473645	missense	possibly damaging	0.51
R1550:Tet2	UTSW	3	133469519	missense	probably benign	0.32
R1647:Tet2	UTSW	3	133485880	missense	probably benign
R1662:Tet2	UTSW	3	133466852	missense	possibly damaging	0.96
R1727:Tet2	UTSW	3	133487290	missense	probably damaging	0.98
R1738:Tet2	UTSW	3	133481387	missense	probably benign	0.08
R1749:Tet2	UTSW	3	133480131	critical splice donor site	probably null
R1869:Tet2	UTSW	3	133481441	splice site	probably null
R1887:Tet2	UTSW	3	133487333	missense	possibly damaging	0.68
R1937:Tet2	UTSW	3	133488638	missense	possibly damaging	0.68
R1939:Tet2	UTSW	3	133488638	missense	possibly damaging	0.68
R1940:Tet2	UTSW	3	133488638	missense	possibly damaging	0.68
R1997:Tet2	UTSW	3	133486589	nonsense	probably null
R2082:Tet2	UTSW	3	133485727	missense	possibly damaging	0.96
R2084:Tet2	UTSW	3	133487767	missense	possibly damaging	0.68
R2215:Tet2	UTSW	3	133486601	missense	probably benign	0.03
R2321:Tet2	UTSW	3	133486339	missense	possibly damaging	0.53
R2873:Tet2	UTSW	3	133486954	missense	probably damaging	1.00
R3439:Tet2	UTSW	3	133466831	missense	possibly damaging	0.93
R3783:Tet2	UTSW	3	133479363	missense	possibly damaging	0.53
R3894:Tet2	UTSW	3	133469477	missense	possibly damaging	0.86
R3916:Tet2	UTSW	3	133486055	missense	possibly damaging	0.53
R3966:Tet2	UTSW	3	133487657	missense	possibly damaging	0.73
R4457:Tet2	UTSW	3	133485563	missense	possibly damaging	0.85
R4633:Tet2	UTSW	3	133485549	missense	probably benign	0.33
R4646:Tet2	UTSW	3	133488082	missense	probably benign	0.02
R4647:Tet2	UTSW	3	133488082	missense	probably benign	0.02
R4648:Tet2	UTSW	3	133488082	missense	probably benign	0.02
R4691:Tet2	UTSW	3	133486083	missense	possibly damaging	0.73
R4805:Tet2	UTSW	3	133467315	missense	probably benign	0.32
R4829:Tet2	UTSW	3	133476620	missense	possibly damaging	0.91
R4901:Tet2	UTSW	3	133467044	missense	possibly damaging	0.86
R4975:Tet2	UTSW	3	133486759	unclassified	probably benign
R5004:Tet2	UTSW	3	133487379	missense	possibly damaging	0.84
R5075:Tet2	UTSW	3	133486906	missense	probably benign
R5137:Tet2	UTSW	3	133476565	missense	probably benign	0.32
R5324:Tet2	UTSW	3	133485913	missense	probably benign	0.00
R5590:Tet2	UTSW	3	133476480	splice site	probably null
R5854:Tet2	UTSW	3	133487885	missense	probably damaging	0.98
R5856:Tet2	UTSW	3	133486640	missense	probably benign	0.01
R5865:Tet2	UTSW	3	133487099	missense	probably benign	0.08
R5879:Tet2	UTSW	3	133487960	missense	possibly damaging	0.96
R5935:Tet2	UTSW	3	133488535	missense	possibly damaging	0.68
R6012:Tet2	UTSW	3	133466781	missense	possibly damaging	0.86
R6075:Tet2	UTSW	3	133471435	missense	possibly damaging	0.71
R6181:Tet2	UTSW	3	133487759	nonsense	probably null
R6188:Tet2	UTSW	3	133480326	missense	probably benign	0.18
R6339:Tet2	UTSW	3	133486417	missense	possibly damaging	0.53
R6612:Tet2	UTSW	3	133487335	missense	possibly damaging	0.53
R6923:Tet2	UTSW	3	133479341	critical splice donor site	probably null
R6934:Tet2	UTSW	3	133483237	critical splice donor site	probably null
R7076:Tet2	UTSW	3	133467023	missense	possibly damaging	0.71
R7155:Tet2	UTSW	3	133469591	missense	possibly damaging	0.71
R7184:Tet2	UTSW	3	133473630	missense	probably damaging	0.98
R7200:Tet2	UTSW	3	133487192	missense	probably benign	0.18
R7459:Tet2	UTSW	3	133480289	missense	possibly damaging	0.53
R7504:Tet2	UTSW	3	133487339	missense	probably benign	0.33
R7524:Tet2	UTSW	3	133480229	missense	probably benign	0.33
R7613:Tet2	UTSW	3	133466748	missense	possibly damaging	0.83
R7653:Tet2	UTSW	3	133486385	missense	probably benign	0.18
R7691:Tet2	UTSW	3	133486849	missense	probably damaging	0.98
R7770:Tet2	UTSW	3	133480295	missense	possibly damaging	0.53
R7807:Tet2	UTSW	3	133486541	missense	possibly damaging	0.53
R7813:Tet2	UTSW	3	133473643	missense	probably benign	0.06
X0021:Tet2	UTSW	3	133486295	missense	possibly damaging	0.85
X0066:Tet2	UTSW	3	133488373	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- GGCATGAACCTCACACTTTGCAC -3'
(R):5'- AACCCCTACCTTGGGCTTTTGAATC -3'

Sequencing Primer
(F):5'- CTTTGCACACTCAATAAGAATTGACC -3'
(R):5'- GCTCAGTCCAGGGATCTACATAG -3'

Posted On

2014-08-19