Incidental Mutation 'R0723:Ddx54'
ID218678
Institutional Source Beutler Lab
Gene Symbol Ddx54
Ensembl Gene ENSMUSG00000029599
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 54
Synonyms2410015A15Rik, APR-5, DP97
MMRRC Submission 038905-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0723 (G1)
Quality Score61
Status Validated
Chromosome5
Chromosomal Location120612739-120628592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120623638 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 493 (D493G)
Ref Sequence ENSEMBL: ENSMUSP00000031598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031598] [ENSMUST00000177908]
Predicted Effect probably benign
Transcript: ENSMUST00000031598
AA Change: D493G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031598
Gene: ENSMUSG00000029599
AA Change: D493G

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Blast:DEXDc 59 101 9e-19 BLAST
DEXDc 114 313 3.5e-58 SMART
HELICc 347 432 7.86e-20 SMART
low complexity region 628 646 N/A INTRINSIC
DBP10CT 706 766 1.45e-25 SMART
low complexity region 778 801 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177908
SMART Domains Protein: ENSMUSP00000137554
Gene: ENSMUSG00000094282

DomainStartEndE-ValueType
Pfam:DUF4200 35 151 2.1e-25 PFAM
coiled coil region 185 231 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201616
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202672
Meta Mutation Damage Score 0.0955 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The nucleolar protein encoded by this gene interacts in a hormone-dependent manner with nuclear receptors, and represses their transcriptional activity. Alternative splice variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,971,691 N341K probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4931423N10Rik T C 2: 23,256,924 probably benign Het
8030411F24Rik T C 2: 148,783,362 I72T probably damaging Het
Acbd5 T G 2: 23,069,596 V54G probably damaging Het
Acin1 A T 14: 54,665,451 S255T probably damaging Het
Adcy2 A G 13: 68,999,129 L56P probably damaging Het
Akap6 G T 12: 53,141,902 C2033F probably damaging Het
Ano5 A G 7: 51,587,758 I777V probably benign Het
Arhgef28 A G 13: 97,939,479 V1349A probably benign Het
Bank1 T C 3: 136,054,403 probably null Het
C2cd5 T C 6: 143,041,555 probably benign Het
Cadps2 A G 6: 23,287,698 V1161A probably damaging Het
Car8 A T 4: 8,169,703 D268E probably benign Het
Ckap5 T A 2: 91,555,331 S175T probably damaging Het
Clk4 T A 11: 51,275,493 Y67* probably null Het
Copg2 T C 6: 30,815,982 I473V possibly damaging Het
Cyp2s1 C T 7: 25,809,548 V43I probably benign Het
Efemp2 T C 19: 5,480,050 S140P probably damaging Het
Fam214a G A 9: 75,009,451 G444E probably damaging Het
Fat1 C A 8: 45,026,749 T2944K probably damaging Het
Fgfr1 T A 8: 25,557,768 D43E probably damaging Het
Fry G A 5: 150,496,360 A996T probably damaging Het
Fyb2 G A 4: 105,015,866 V784I probably benign Het
Gm6507 T A 6: 89,185,162 noncoding transcript Het
Gm7964 T C 7: 83,756,166 noncoding transcript Het
Gucy2c T C 6: 136,727,801 probably null Het
Hdac10 A T 15: 89,126,418 L259Q probably damaging Het
Hoxd9 A T 2: 74,698,828 D258V probably damaging Het
Hs3st3b1 T C 11: 63,921,575 T105A probably benign Het
Hsd17b7 A G 1: 169,956,026 L271P probably damaging Het
Ifnlr1 T A 4: 135,701,213 probably benign Het
Kif22 A T 7: 127,033,906 M121K probably damaging Het
Kl G A 5: 150,953,101 D129N probably damaging Het
Mettl13 A T 1: 162,534,430 I648N probably damaging Het
Mlh1 C T 9: 111,271,472 R18H probably damaging Het
Mtmr14 T C 6: 113,270,512 probably benign Het
Myo15 C A 11: 60,478,977 N854K possibly damaging Het
Myo1h T C 5: 114,319,680 I84T probably benign Het
Myo9a A T 9: 59,871,100 S1380C probably benign Het
Myof A G 19: 37,981,260 V318A probably damaging Het
N4bp2l2 A G 5: 150,662,432 S28P probably damaging Het
Narfl G A 17: 25,781,821 V406M probably damaging Het
Nbr1 C T 11: 101,576,319 Q570* probably null Het
Nhp2 C T 11: 51,619,923 Q36* probably null Het
Olfr23 T G 11: 73,940,270 V8G probably benign Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Poc1b T A 10: 99,129,595 W129R probably damaging Het
Rapgef2 C T 3: 79,079,174 E1018K probably benign Het
Rgs12 T C 5: 35,024,366 probably benign Het
Rufy2 G A 10: 62,998,094 V280I probably benign Het
Snx2 A G 18: 53,210,372 I281V probably benign Het
Spag5 C A 11: 78,319,584 probably benign Het
Stxbp5 A T 10: 9,768,873 I961N probably damaging Het
Tet2 T C 3: 133,467,284 E1739G probably benign Het
Tmod2 A G 9: 75,595,055 F50S possibly damaging Het
Tnfsf13b T G 8: 10,007,166 probably null Het
Ttn T C 2: 76,786,335 K16525E possibly damaging Het
Txnrd2 T C 16: 18,440,879 probably benign Het
Ubr1 A T 2: 120,881,101 Y1437* probably null Het
Vwf C A 6: 125,566,262 D170E probably benign Het
Wdr95 C G 5: 149,574,048 I230M probably damaging Het
Xirp2 C T 2: 67,512,215 S1600F probably damaging Het
Zfp12 A G 5: 143,244,883 K322E probably damaging Het
Other mutations in Ddx54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Ddx54 APN 5 120623810 critical splice donor site probably null
IGL01324:Ddx54 APN 5 120623638 missense probably benign 0.00
IGL01399:Ddx54 APN 5 120623903 nonsense probably null
IGL02052:Ddx54 APN 5 120625718 missense possibly damaging 0.93
IGL02095:Ddx54 APN 5 120623791 missense possibly damaging 0.81
IGL02370:Ddx54 APN 5 120619787 missense probably damaging 1.00
IGL02861:Ddx54 APN 5 120618130 splice site probably benign
R0521:Ddx54 UTSW 5 120626862 missense probably benign 0.00
R0556:Ddx54 UTSW 5 120619654 splice site probably benign
R2968:Ddx54 UTSW 5 120618629 missense probably damaging 1.00
R4622:Ddx54 UTSW 5 120626423 missense probably damaging 1.00
R4853:Ddx54 UTSW 5 120623629 missense probably benign 0.12
R5168:Ddx54 UTSW 5 120617032 missense probably benign 0.00
R5169:Ddx54 UTSW 5 120623263 missense probably damaging 1.00
R5424:Ddx54 UTSW 5 120619861 critical splice donor site probably null
R5489:Ddx54 UTSW 5 120624721 missense probably benign
R5956:Ddx54 UTSW 5 120626367 unclassified probably benign
R5999:Ddx54 UTSW 5 120623580 missense probably benign 0.00
R6220:Ddx54 UTSW 5 120620689 missense probably benign 0.09
R6413:Ddx54 UTSW 5 120627062 missense probably benign
R6477:Ddx54 UTSW 5 120621778 missense probably damaging 1.00
R6702:Ddx54 UTSW 5 120626503 missense possibly damaging 0.52
R6783:Ddx54 UTSW 5 120618714 nonsense probably null
R6865:Ddx54 UTSW 5 120621827 critical splice donor site probably null
R7258:Ddx54 UTSW 5 120620747 missense probably damaging 1.00
R7260:Ddx54 UTSW 5 120626920 missense probably benign 0.21
R7488:Ddx54 UTSW 5 120624724 missense probably benign
R7887:Ddx54 UTSW 5 120627203 missense probably damaging 1.00
R7970:Ddx54 UTSW 5 120627203 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTTGGGCTATTGTTGCCAGAG -3'
(R):5'- TCGTGCTCACAAGAACGTCCATCC -3'

Sequencing Primer
(F):5'- CTATTGTTGCCAGAGTGGGG -3'
(R):5'- TGCCCAGCTTACTGAAGAGTG -3'
Posted On2014-08-19