Mutagenetix > Incidental Mutation

Incidental Mutation 'R0659:Mroh2a'

218690

Institutional Source

Beutler Lab

Gene Symbol

Mroh2a

Ensembl Gene

ENSMUSG00000079429

Gene Name

maestro heat-like repeat family member 2A

Synonyms

Heatr7b1, ENSMUSG00000044873, OTTMUSG00000020804

MMRRC Submission

038844-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.927) question?

Stock #

R0659 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

88226986-88262289 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 88250342 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 1053 (D1053N)

Ref Sequence

ENSEMBL: ENSMUSP00000130508 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061013] [ENSMUST00000113130]

AlphaFold

D3Z750

Predicted Effect

probably damaging
Transcript: ENSMUST00000061013
AA Change: D1053N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429
AA Change: D1053N

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1235	1248	N/A	INTRINSIC
SCOP:d1jdha_	1371	1669	9e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113130
AA Change: D1050N

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429
AA Change: D1050N

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1232	1245	N/A	INTRINSIC
SCOP:d1gw5a_	1446	1671	6e-6	SMART

Meta Mutation Damage Score

0.3311

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 95.6%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts19	A	G	18: 59,007,493		probably benign	Het
Ahnak	A	G	19: 9,015,002	H4550R	possibly damaging	Het
Anxa6	A	G	11: 54,983,347	V591A	probably damaging	Het
Apol7c	A	G	15: 77,526,273	S158P	probably damaging	Het
Asxl1	T	A	2: 153,400,724	S1065T	possibly damaging	Het
Cacna2d4	A	G	6: 119,345,106		probably benign	Het
Cd109	T	C	9: 78,680,170		probably benign	Het
Cep78	C	T	19: 15,956,190	V675M	probably damaging	Het
Ces4a	T	C	8: 105,144,922		probably benign	Het
Chpf	A	G	1: 75,477,723	V137A	probably damaging	Het
Comp	T	C	8: 70,379,101	S457P	possibly damaging	Het
Cth	A	G	3: 157,920,115		probably benign	Het
Cyp2a12	T	C	7: 27,034,138	L314P	probably damaging	Het
Ets1	C	T	9: 32,738,293	R309C	probably damaging	Het
Fam208b	T	C	13: 3,574,448	D1834G	probably damaging	Het
Foxp2	T	C	6: 15,254,279		probably benign	Het
Gm9875	T	G	2: 13,558,184	F108V	unknown	Het
Golga5	G	T	12: 102,476,208	V269F	possibly damaging	Het
Greb1	T	C	12: 16,680,212	Y1738C	probably damaging	Het
Grin2a	G	T	16: 9,992,472	P21Q	probably damaging	Het
Hdac5	A	T	11: 102,196,024	V70E	probably damaging	Het
Hdac9	T	C	12: 34,437,222	Q60R	probably damaging	Het
Hsd17b3	T	C	13: 64,073,936	T92A	possibly damaging	Het
Itpk1	C	T	12: 102,606,078		probably benign	Het
Lin28a	T	C	4: 134,008,099		probably benign	Het
Mapk6	T	C	9: 75,397,962	S58G	probably damaging	Het
Mmp21	G	A	7: 133,677,667		probably benign	Het
Msh3	T	C	13: 92,345,096	N303D	possibly damaging	Het
Mto1	T	A	9: 78,457,508	I343N	probably damaging	Het
Mto1	C	T	9: 78,470,790	T638M	probably damaging	Het
Myo18b	T	C	5: 112,760,327	K2027E	possibly damaging	Het
Myo7a	T	C	7: 98,054,338		probably benign	Het
Nlrp9a	T	C	7: 26,557,278	I107T	probably damaging	Het
Olfr181	C	A	16: 58,926,409	R54L	possibly damaging	Het
Olfr970	T	G	9: 39,819,816	M59R	possibly damaging	Het
Osbpl5	A	G	7: 143,705,030	S268P	probably damaging	Het
Pih1d1	T	A	7: 45,159,975	S289T	probably benign	Het
Pik3c2b	A	G	1: 133,071,200	D353G	probably damaging	Het
Ppef2	A	G	5: 92,230,509	L609P	probably damaging	Het
Prune2	A	T	19: 17,122,835	D1901V	probably damaging	Het
Rdh9	T	C	10: 127,776,575	Y31H	possibly damaging	Het
Slc5a9	T	A	4: 111,883,871	Y526F	possibly damaging	Het
Slitrk5	A	G	14: 111,680,689	K582E	probably benign	Het
Sult1c2	A	T	17: 53,831,778	M257K	probably damaging	Het
Tmem132d	A	G	5: 127,984,287	I417T	possibly damaging	Het
Tmem229b	T	C	12: 78,965,134	T8A	probably benign	Het
Tmem237	T	C	1: 59,114,094	I89M	possibly damaging	Het
Tnfrsf17	A	T	16: 11,319,819	D140V	probably damaging	Het
Tnrc6b	T	A	15: 80,923,446		probably benign	Het
Trio	A	G	15: 27,831,399	L194P	probably damaging	Het
Vmn2r74	T	C	7: 85,955,914		probably benign	Het
Vps13c	T	A	9: 67,920,935	M1457K	probably benign	Het
Zfhx2	A	G	14: 55,073,801	C479R	possibly damaging	Het
Zfp420	T	A	7: 29,875,539	C395S	probably damaging	Het
Zfp740	A	G	15: 102,212,659	T136A	possibly damaging	Het
Zfp82	C	T	7: 30,056,329	E443K	probably damaging	Het
Zranb2	A	G	3: 157,541,763	S193G	probably benign	Het

Other mutations in Mroh2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Mroh2a	APN	1	88,244,970 (GRCm38)	missense	probably benign	0.03
IGL00990:Mroh2a	APN	1	88,230,746 (GRCm38)	missense	probably damaging	0.99
IGL00990:Mroh2a	APN	1	88,234,120 (GRCm38)	missense	possibly damaging	0.76
IGL03097:Mroh2a	UTSW	1	88,235,376 (GRCm38)	missense	probably benign	0.30
R0032:Mroh2a	UTSW	1	88,256,166 (GRCm38)	frame shift	probably null
R0068:Mroh2a	UTSW	1	88,256,166 (GRCm38)	frame shift	probably null
R0139:Mroh2a	UTSW	1	88,257,802 (GRCm38)	missense	probably damaging	1.00
R0197:Mroh2a	UTSW	1	88,246,042 (GRCm38)	missense	probably damaging	1.00
R0242:Mroh2a	UTSW	1	88,242,420 (GRCm38)	missense	possibly damaging	0.77
R0322:Mroh2a	UTSW	1	88,230,680 (GRCm38)	nonsense	probably null
R0374:Mroh2a	UTSW	1	88,242,420 (GRCm38)	missense	possibly damaging	0.77
R0387:Mroh2a	UTSW	1	88,246,042 (GRCm38)	missense	probably damaging	1.00
R0412:Mroh2a	UTSW	1	88,235,216 (GRCm38)	missense	probably benign	0.01
R0536:Mroh2a	UTSW	1	88,258,664 (GRCm38)	missense	probably benign	0.00
R0548:Mroh2a	UTSW	1	88,242,420 (GRCm38)	missense	possibly damaging	0.77
R0580:Mroh2a	UTSW	1	88,243,950 (GRCm38)	missense	probably damaging	1.00
R0581:Mroh2a	UTSW	1	88,256,166 (GRCm38)	frame shift	probably null
R0583:Mroh2a	UTSW	1	88,256,166 (GRCm38)	frame shift	probably null
R0613:Mroh2a	UTSW	1	88,243,950 (GRCm38)	missense	probably damaging	1.00
R0652:Mroh2a	UTSW	1	88,230,680 (GRCm38)	nonsense	probably null
R0657:Mroh2a	UTSW	1	88,255,565 (GRCm38)	missense	probably damaging	1.00
R0659:Mroh2a	UTSW	1	88,242,420 (GRCm38)	missense	possibly damaging	0.77
R0671:Mroh2a	UTSW	1	88,242,420 (GRCm38)	missense	possibly damaging	0.77
R0675:Mroh2a	UTSW	1	88,250,342 (GRCm38)	missense	probably damaging	1.00
R0675:Mroh2a	UTSW	1	88,228,380 (GRCm38)	missense	probably damaging	0.99
R0689:Mroh2a	UTSW	1	88,258,664 (GRCm38)	missense	probably benign	0.00
R0689:Mroh2a	UTSW	1	88,230,680 (GRCm38)	nonsense	probably null
R0735:Mroh2a	UTSW	1	88,243,950 (GRCm38)	missense	probably damaging	1.00
R0761:Mroh2a	UTSW	1	88,243,950 (GRCm38)	missense	probably damaging	1.00
R0766:Mroh2a	UTSW	1	88,230,680 (GRCm38)	nonsense	probably null
R0845:Mroh2a	UTSW	1	88,258,664 (GRCm38)	missense	probably benign	0.00
R0853:Mroh2a	UTSW	1	88,258,664 (GRCm38)	missense	probably benign	0.00
R0959:Mroh2a	UTSW	1	88,232,257 (GRCm38)	frame shift	probably null
R0960:Mroh2a	UTSW	1	88,242,420 (GRCm38)	missense	possibly damaging	0.77
R1004:Mroh2a	UTSW	1	88,242,420 (GRCm38)	missense	possibly damaging	0.77
R1013:Mroh2a	UTSW	1	88,234,612 (GRCm38)	critical splice donor site	probably null
R1028:Mroh2a	UTSW	1	88,235,376 (GRCm38)	missense	probably benign	0.30
R1268:Mroh2a	UTSW	1	88,230,680 (GRCm38)	nonsense	probably null
R1281:Mroh2a	UTSW	1	88,256,167 (GRCm38)	frame shift	probably null
R1414:Mroh2a	UTSW	1	88,258,664 (GRCm38)	missense	probably benign	0.00
R1439:Mroh2a	UTSW	1	88,257,802 (GRCm38)	missense	probably damaging	1.00
R1441:Mroh2a	UTSW	1	88,241,631 (GRCm38)	missense	possibly damaging	0.93
R1442:Mroh2a	UTSW	1	88,232,353 (GRCm38)	splice site	probably benign
R1442:Mroh2a	UTSW	1	88,242,420 (GRCm38)	missense	possibly damaging	0.77
R1465:Mroh2a	UTSW	1	88,257,802 (GRCm38)	missense	probably damaging	1.00
R1662:Mroh2a	UTSW	1	88,241,618 (GRCm38)	missense	probably benign	0.07
R1686:Mroh2a	UTSW	1	88,234,612 (GRCm38)	critical splice donor site	probably null
R1686:Mroh2a	UTSW	1	88,230,680 (GRCm38)	nonsense	probably null
R1780:Mroh2a	UTSW	1	88,230,680 (GRCm38)	nonsense	probably null
R1846:Mroh2a	UTSW	1	88,258,664 (GRCm38)	missense	probably benign	0.00
R1899:Mroh2a	UTSW	1	88,235,376 (GRCm38)	missense	probably benign	0.30
R1958:Mroh2a	UTSW	1	88,237,491 (GRCm38)	nonsense	probably null
R2122:Mroh2a	UTSW	1	88,256,754 (GRCm38)	missense	probably benign	0.37
R2248:Mroh2a	UTSW	1	88,256,754 (GRCm38)	missense	probably benign	0.37
R2306:Mroh2a	UTSW	1	88,258,664 (GRCm38)	missense	probably benign	0.00
R2869:Mroh2a	UTSW	1	88,232,257 (GRCm38)	frame shift	probably null
R2870:Mroh2a	UTSW	1	88,232,257 (GRCm38)	frame shift	probably null
R2871:Mroh2a	UTSW	1	88,255,565 (GRCm38)	missense	probably damaging	1.00
R2872:Mroh2a	UTSW	1	88,232,257 (GRCm38)	frame shift	probably null
R3408:Mroh2a	UTSW	1	88,232,257 (GRCm38)	frame shift	probably null
R3608:Mroh2a	UTSW	1	88,244,995 (GRCm38)	missense	probably damaging	1.00
R3730:Mroh2a	UTSW	1	88,232,257 (GRCm38)	frame shift	probably null
R3937:Mroh2a	UTSW	1	88,258,664 (GRCm38)	missense	probably benign	0.00
R4022:Mroh2a	UTSW	1	88,246,042 (GRCm38)	missense	probably damaging	1.00
R4049:Mroh2a	UTSW	1	88,258,664 (GRCm38)	missense	probably benign	0.00
R4133:Mroh2a	UTSW	1	88,254,965 (GRCm38)	missense	possibly damaging	0.95
R4361:Mroh2a	UTSW	1	88,254,965 (GRCm38)	missense	possibly damaging	0.95
R4392:Mroh2a	UTSW	1	88,259,589 (GRCm38)	missense	probably damaging	1.00
R4401:Mroh2a	UTSW	1	88,254,935 (GRCm38)	missense	possibly damaging	0.72
R4402:Mroh2a	UTSW	1	88,254,935 (GRCm38)	missense	possibly damaging	0.72
R4575:Mroh2a	UTSW	1	88,258,664 (GRCm38)	missense	probably benign	0.00
R4625:Mroh2a	UTSW	1	88,254,965 (GRCm38)	missense	possibly damaging	0.95
R4631:Mroh2a	UTSW	1	88,258,664 (GRCm38)	missense	probably benign	0.00
R4665:Mroh2a	UTSW	1	88,241,618 (GRCm38)	missense	probably benign	0.07
R4701:Mroh2a	UTSW	1	88,234,612 (GRCm38)	critical splice donor site	probably null
R4701:Mroh2a	UTSW	1	88,241,618 (GRCm38)	missense	probably benign	0.07
R4771:Mroh2a	UTSW	1	88,251,365 (GRCm38)	missense	probably damaging	1.00
R4795:Mroh2a	UTSW	1	88,258,664 (GRCm38)	missense	probably benign	0.00
R4839:Mroh2a	UTSW	1	88,237,944 (GRCm38)	missense	probably damaging	1.00
R4873:Mroh2a	UTSW	1	88,254,935 (GRCm38)	missense	possibly damaging	0.72
R4875:Mroh2a	UTSW	1	88,254,935 (GRCm38)	missense	possibly damaging	0.72
R4896:Mroh2a	UTSW	1	88,256,754 (GRCm38)	missense	probably benign	0.37
R5007:Mroh2a	UTSW	1	88,232,257 (GRCm38)	frame shift	probably null
R5031:Mroh2a	UTSW	1	88,232,257 (GRCm38)	frame shift	probably null
R5062:Mroh2a	UTSW	1	88,232,257 (GRCm38)	frame shift	probably null
R5301:Mroh2a	UTSW	1	88,258,664 (GRCm38)	missense	probably benign	0.00
R5367:Mroh2a	UTSW	1	88,254,965 (GRCm38)	missense	possibly damaging	0.95
R5371:Mroh2a	UTSW	1	88,258,664 (GRCm38)	missense	probably benign	0.00
R5446:Mroh2a	UTSW	1	88,254,965 (GRCm38)	missense	possibly damaging	0.95
R5484:Mroh2a	UTSW	1	88,258,664 (GRCm38)	missense	probably benign	0.00
R5506:Mroh2a	UTSW	1	88,258,664 (GRCm38)	missense	probably benign	0.00
R5561:Mroh2a	UTSW	1	88,232,257 (GRCm38)	frame shift	probably null
R5615:Mroh2a	UTSW	1	88,232,257 (GRCm38)	frame shift	probably null
R5825:Mroh2a	UTSW	1	88,230,680 (GRCm38)	nonsense	probably null
R5891:Mroh2a	UTSW	1	88,241,615 (GRCm38)	missense	possibly damaging	0.93
R5906:Mroh2a	UTSW	1	88,258,664 (GRCm38)	missense	probably benign	0.00
R5928:Mroh2a	UTSW	1	88,241,618 (GRCm38)	missense	probably benign	0.07
R6004:Mroh2a	UTSW	1	88,248,655 (GRCm38)	missense	probably damaging	1.00
R6035:Mroh2a	UTSW	1	88,230,668 (GRCm38)	missense	probably damaging	1.00
R6064:Mroh2a	UTSW	1	88,232,257 (GRCm38)	frame shift	probably null
R6074:Mroh2a	UTSW	1	88,258,664 (GRCm38)	missense	probably benign	0.00
R6091:Mroh2a	UTSW	1	88,232,257 (GRCm38)	frame shift	probably null
R6127:Mroh2a	UTSW	1	88,234,612 (GRCm38)	critical splice donor site	probably null
R6234:Mroh2a	UTSW	1	88,256,754 (GRCm38)	missense	probably benign	0.37
R6234:Mroh2a	UTSW	1	88,234,612 (GRCm38)	critical splice donor site	probably null
R6244:Mroh2a	UTSW	1	88,256,754 (GRCm38)	missense	probably benign	0.37
R6464:Mroh2a	UTSW	1	88,257,802 (GRCm38)	missense	probably damaging	1.00
R6465:Mroh2a	UTSW	1	88,232,257 (GRCm38)	frame shift	probably null
R6575:Mroh2a	UTSW	1	88,232,257 (GRCm38)	frame shift	probably null
R6809:Mroh2a	UTSW	1	88,235,216 (GRCm38)	missense	probably benign	0.01
R6819:Mroh2a	UTSW	1	88,242,420 (GRCm38)	missense	possibly damaging	0.77
R6854:Mroh2a	UTSW	1	88,243,950 (GRCm38)	missense	probably damaging	1.00
R6860:Mroh2a	UTSW	1	88,254,935 (GRCm38)	missense	possibly damaging	0.72
R7126:Mroh2a	UTSW	1	88,254,935 (GRCm38)	missense	possibly damaging	0.72
R7818:Mroh2a	UTSW	1	88,234,612 (GRCm38)	critical splice donor site	probably null
R8350:Mroh2a	UTSW	1	88,244,083 (GRCm38)	splice site	probably null
R9414:Mroh2a	UTSW	1	88,251,374 (GRCm38)	missense	probably benign	0.26
RF024:Mroh2a	UTSW	1	88,242,485 (GRCm38)	missense	probably damaging	1.00
V5622:Mroh2a	UTSW	1	88,227,091 (GRCm38)	start gained	probably benign
V8831:Mroh2a	UTSW	1	88,256,167 (GRCm38)	frame shift	probably null
X0027:Mroh2a	UTSW	1	88,248,613 (GRCm38)	missense	possibly damaging	0.86
X0028:Mroh2a	UTSW	1	88,256,166 (GRCm38)	frame shift	probably null
X0028:Mroh2a	UTSW	1	88,232,257 (GRCm38)	frame shift	probably null
X0033:Mroh2a	UTSW	1	88,256,166 (GRCm38)	frame shift	probably null
X0034:Mroh2a	UTSW	1	88,256,166 (GRCm38)	frame shift	probably null
X0034:Mroh2a	UTSW	1	88,232,292 (GRCm38)	missense	probably damaging	1.00
X0034:Mroh2a	UTSW	1	88,232,257 (GRCm38)	frame shift	probably null
X0039:Mroh2a	UTSW	1	88,232,257 (GRCm38)	frame shift	probably null
X0057:Mroh2a	UTSW	1	88,256,166 (GRCm38)	frame shift	probably null
X0057:Mroh2a	UTSW	1	88,255,655 (GRCm38)	missense	probably benign	0.25
X0057:Mroh2a	UTSW	1	88,232,257 (GRCm38)	frame shift	probably null
X0063:Mroh2a	UTSW	1	88,232,257 (GRCm38)	frame shift	probably null
Z1188:Mroh2a	UTSW	1	88,235,216 (GRCm38)	missense	probably benign	0.01
Z1190:Mroh2a	UTSW	1	88,232,257 (GRCm38)	frame shift	probably null
Z1192:Mroh2a	UTSW	1	88,235,216 (GRCm38)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTGCAGATACCAAGGGAGCCACAG -3'
(R):5'- TCTTGGAGGACTCAGCTAGGGAATG -3'

Sequencing Primer
(F):5'- TAAAGGCTGTTGTGTTGAAGGAAC -3'
(R):5'- TTATGTCCCAGCTACTACAAGC -3'

Posted On

2014-08-20