Mutagenetix > Incidental Mutations

Incidental Mutation 'R0659:Cth'

218692

Institutional Source

Beutler Lab

Gene Symbol

Cth

Ensembl Gene

ENSMUSG00000028179

Gene Name

cystathionase (cystathionine gamma-lyase)

Synonyms

CSE, 0610010I13Rik

MMRRC Submission

038844-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0659 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

157894248-157925077 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 157920115 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000113672 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118539]

Predicted Effect

probably benign
Transcript: ENSMUST00000118539

SMART Domains

Protein: ENSMUSP00000113672
Gene: ENSMUSG00000028179

Domain	Start	End	E-Value	Type
Pfam:Cys_Met_Meta_PP	18	394	5.8e-157	PFAM
Pfam:Aminotran_1_2	32	235	4.3e-9	PFAM
Pfam:DegT_DnrJ_EryC1	53	246	1.9e-7	PFAM
Pfam:Aminotran_5	68	232	4e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125028

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 95.6%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic enzyme in the trans-sulfuration pathway that converts cystathione derived from methionine into cysteine. Glutathione synthesis in the liver is dependent upon the availability of cysteine. Mutations in this gene cause cystathioninuria. Alternative splicing of this gene results in three transcript variants encoding different isoforms. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit hypertension associated with impaired endothelium-dependent vasorelaxation. Mice homozygous for another knock-out allele exhibit normal blood pressure but sensitivty to a low cysteine diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts19	A	G	18: 59,007,493		probably benign	Het
Ahnak	A	G	19: 9,015,002	H4550R	possibly damaging	Het
Anxa6	A	G	11: 54,983,347	V591A	probably damaging	Het
Apol7c	A	G	15: 77,526,273	S158P	probably damaging	Het
Asxl1	T	A	2: 153,400,724	S1065T	possibly damaging	Het
Cacna2d4	A	G	6: 119,345,106		probably benign	Het
Cd109	T	C	9: 78,680,170		probably benign	Het
Cep78	C	T	19: 15,956,190	V675M	probably damaging	Het
Ces4a	T	C	8: 105,144,922		probably benign	Het
Chpf	A	G	1: 75,477,723	V137A	probably damaging	Het
Comp	T	C	8: 70,379,101	S457P	possibly damaging	Het
Cyp2a12	T	C	7: 27,034,138	L314P	probably damaging	Het
Ets1	C	T	9: 32,738,293	R309C	probably damaging	Het
Fam208b	T	C	13: 3,574,448	D1834G	probably damaging	Het
Foxp2	T	C	6: 15,254,279		probably benign	Het
Gm9875	T	G	2: 13,558,184	F108V	unknown	Het
Golga5	G	T	12: 102,476,208	V269F	possibly damaging	Het
Greb1	T	C	12: 16,680,212	Y1738C	probably damaging	Het
Grin2a	G	T	16: 9,992,472	P21Q	probably damaging	Het
Hdac5	A	T	11: 102,196,024	V70E	probably damaging	Het
Hdac9	T	C	12: 34,437,222	Q60R	probably damaging	Het
Hsd17b3	T	C	13: 64,073,936	T92A	possibly damaging	Het
Itpk1	C	T	12: 102,606,078		probably benign	Het
Lin28a	T	C	4: 134,008,099		probably benign	Het
Mapk6	T	C	9: 75,397,962	S58G	probably damaging	Het
Mmp21	G	A	7: 133,677,667		probably benign	Het
Mroh2a	C	A	1: 88,242,420	A685D	possibly damaging	Het
Mroh2a	G	A	1: 88,250,342	D1053N	probably damaging	Het
Msh3	T	C	13: 92,345,096	N303D	possibly damaging	Het
Mto1	T	A	9: 78,457,508	I343N	probably damaging	Het
Mto1	C	T	9: 78,470,790	T638M	probably damaging	Het
Myo18b	T	C	5: 112,760,327	K2027E	possibly damaging	Het
Myo7a	T	C	7: 98,054,338		probably benign	Het
Nlrp9a	T	C	7: 26,557,278	I107T	probably damaging	Het
Olfr181	C	A	16: 58,926,409	R54L	possibly damaging	Het
Olfr970	T	G	9: 39,819,816	M59R	possibly damaging	Het
Osbpl5	A	G	7: 143,705,030	S268P	probably damaging	Het
Pih1d1	T	A	7: 45,159,975	S289T	probably benign	Het
Pik3c2b	A	G	1: 133,071,200	D353G	probably damaging	Het
Ppef2	A	G	5: 92,230,509	L609P	probably damaging	Het
Prune2	A	T	19: 17,122,835	D1901V	probably damaging	Het
Rdh9	T	C	10: 127,776,575	Y31H	possibly damaging	Het
Slc5a9	T	A	4: 111,883,871	Y526F	possibly damaging	Het
Slitrk5	A	G	14: 111,680,689	K582E	probably benign	Het
Sult1c2	A	T	17: 53,831,778	M257K	probably damaging	Het
Tmem132d	A	G	5: 127,984,287	I417T	possibly damaging	Het
Tmem229b	T	C	12: 78,965,134	T8A	probably benign	Het
Tmem237	T	C	1: 59,114,094	I89M	possibly damaging	Het
Tnfrsf17	A	T	16: 11,319,819	D140V	probably damaging	Het
Tnrc6b	T	A	15: 80,923,446		probably benign	Het
Trio	A	G	15: 27,831,399	L194P	probably damaging	Het
Vmn2r74	T	C	7: 85,955,914		probably benign	Het
Vps13c	T	A	9: 67,920,935	M1457K	probably benign	Het
Zfhx2	A	G	14: 55,073,801	C479R	possibly damaging	Het
Zfp420	T	A	7: 29,875,539	C395S	probably damaging	Het
Zfp740	A	G	15: 102,212,659	T136A	possibly damaging	Het
Zfp82	C	T	7: 30,056,329	E443K	probably damaging	Het
Zranb2	A	G	3: 157,541,763	S193G	probably benign	Het

Other mutations in Cth

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01462:Cth	APN	3	157905167	missense	probably damaging	0.99
IGL01744:Cth	APN	3	157924935	missense	probably benign
IGL03128:Cth	APN	3	157921035	missense	probably damaging	1.00
R0477:Cth	UTSW	3	157905175	missense	probably damaging	1.00
R1699:Cth	UTSW	3	157907436	missense	probably damaging	1.00
R1724:Cth	UTSW	3	157913727	missense	probably damaging	1.00
R1744:Cth	UTSW	3	157906268	missense	probably damaging	0.99
R3822:Cth	UTSW	3	157918499	missense	probably benign	0.27
R3937:Cth	UTSW	3	157920040	missense	possibly damaging	0.79
R3982:Cth	UTSW	3	157913697	nonsense	probably null
R4342:Cth	UTSW	3	157924976	missense	probably damaging	1.00
R5436:Cth	UTSW	3	157894826	missense	probably benign
R7466:Cth	UTSW	3	157924885	missense	probably benign	0.05
R8348:Cth	UTSW	3	157925020	missense	probably benign	0.19
R8448:Cth	UTSW	3	157925020	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- GCCACCTTTGAAAGAACATTGTCCC -3'
(R):5'- TCAGGCTATCACTGTGCTCATTTGC -3'

Sequencing Primer
(F):5'- TGTCCCTGAAAGTGGAATAGTACC -3'
(R):5'- TCAATATCTACCCTCtgtgtgtg -3'

Posted On

2014-08-20