Mutagenetix > Incidental Mutation

Incidental Mutation 'R0659:Cd109'

218699

Institutional Source

Beutler Lab

Gene Symbol

Cd109

Ensembl Gene

ENSMUSG00000046186

Gene Name

CD109 antigen

Synonyms

Gov platelet alloantigens, 9930012E15Rik

MMRRC Submission

038844-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0659 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

78615546-78716253 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 78680170 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000091330 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093812]

AlphaFold

Q8R422

Predicted Effect

probably benign
Transcript: ENSMUST00000093812

SMART Domains

Protein: ENSMUSP00000091330
Gene: ENSMUSG00000046186

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:A2M_N	129	220	1.5e-16	PFAM
A2M_N_2	470	601	8.89e-32	SMART
A2M	695	786	2.07e-32	SMART
Pfam:Thiol-ester_cl	912	941	2.6e-20	PFAM
Pfam:A2M_comp	961	1197	1.9e-65	PFAM
low complexity region	1265	1275	N/A	INTRINSIC
A2M_recep	1311	1395	2.06e-27	SMART
low complexity region	1422	1437	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 95.6%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl phosphatidylinositol (GPI)-linked glycoprotein that localizes to the surface of platelets, activated T-cells, and endothelial cells. The protein binds to and negatively regulates signalling by transforming growth factor beta (TGF-beta). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a null mutation display epidermal hyperplasia and thickening, sebaceous gland hyperplasia and transient impairment of hair growth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts19	A	G	18: 59,007,493		probably benign	Het
Ahnak	A	G	19: 9,015,002	H4550R	possibly damaging	Het
Anxa6	A	G	11: 54,983,347	V591A	probably damaging	Het
Apol7c	A	G	15: 77,526,273	S158P	probably damaging	Het
Asxl1	T	A	2: 153,400,724	S1065T	possibly damaging	Het
Cacna2d4	A	G	6: 119,345,106		probably benign	Het
Cep78	C	T	19: 15,956,190	V675M	probably damaging	Het
Ces4a	T	C	8: 105,144,922		probably benign	Het
Chpf	A	G	1: 75,477,723	V137A	probably damaging	Het
Comp	T	C	8: 70,379,101	S457P	possibly damaging	Het
Cth	A	G	3: 157,920,115		probably benign	Het
Cyp2a12	T	C	7: 27,034,138	L314P	probably damaging	Het
Ets1	C	T	9: 32,738,293	R309C	probably damaging	Het
Fam208b	T	C	13: 3,574,448	D1834G	probably damaging	Het
Foxp2	T	C	6: 15,254,279		probably benign	Het
Gm9875	T	G	2: 13,558,184	F108V	unknown	Het
Golga5	G	T	12: 102,476,208	V269F	possibly damaging	Het
Greb1	T	C	12: 16,680,212	Y1738C	probably damaging	Het
Grin2a	G	T	16: 9,992,472	P21Q	probably damaging	Het
Hdac5	A	T	11: 102,196,024	V70E	probably damaging	Het
Hdac9	T	C	12: 34,437,222	Q60R	probably damaging	Het
Hsd17b3	T	C	13: 64,073,936	T92A	possibly damaging	Het
Itpk1	C	T	12: 102,606,078		probably benign	Het
Lin28a	T	C	4: 134,008,099		probably benign	Het
Mapk6	T	C	9: 75,397,962	S58G	probably damaging	Het
Mmp21	G	A	7: 133,677,667		probably benign	Het
Mroh2a	C	A	1: 88,242,420	A685D	possibly damaging	Het
Mroh2a	G	A	1: 88,250,342	D1053N	probably damaging	Het
Msh3	T	C	13: 92,345,096	N303D	possibly damaging	Het
Mto1	T	A	9: 78,457,508	I343N	probably damaging	Het
Mto1	C	T	9: 78,470,790	T638M	probably damaging	Het
Myo18b	T	C	5: 112,760,327	K2027E	possibly damaging	Het
Myo7a	T	C	7: 98,054,338		probably benign	Het
Nlrp9a	T	C	7: 26,557,278	I107T	probably damaging	Het
Olfr181	C	A	16: 58,926,409	R54L	possibly damaging	Het
Olfr970	T	G	9: 39,819,816	M59R	possibly damaging	Het
Osbpl5	A	G	7: 143,705,030	S268P	probably damaging	Het
Pih1d1	T	A	7: 45,159,975	S289T	probably benign	Het
Pik3c2b	A	G	1: 133,071,200	D353G	probably damaging	Het
Ppef2	A	G	5: 92,230,509	L609P	probably damaging	Het
Prune2	A	T	19: 17,122,835	D1901V	probably damaging	Het
Rdh9	T	C	10: 127,776,575	Y31H	possibly damaging	Het
Slc5a9	T	A	4: 111,883,871	Y526F	possibly damaging	Het
Slitrk5	A	G	14: 111,680,689	K582E	probably benign	Het
Sult1c2	A	T	17: 53,831,778	M257K	probably damaging	Het
Tmem132d	A	G	5: 127,984,287	I417T	possibly damaging	Het
Tmem229b	T	C	12: 78,965,134	T8A	probably benign	Het
Tmem237	T	C	1: 59,114,094	I89M	possibly damaging	Het
Tnfrsf17	A	T	16: 11,319,819	D140V	probably damaging	Het
Tnrc6b	T	A	15: 80,923,446		probably benign	Het
Trio	A	G	15: 27,831,399	L194P	probably damaging	Het
Vmn2r74	T	C	7: 85,955,914		probably benign	Het
Vps13c	T	A	9: 67,920,935	M1457K	probably benign	Het
Zfhx2	A	G	14: 55,073,801	C479R	possibly damaging	Het
Zfp420	T	A	7: 29,875,539	C395S	probably damaging	Het
Zfp740	A	G	15: 102,212,659	T136A	possibly damaging	Het
Zfp82	C	T	7: 30,056,329	E443K	probably damaging	Het
Zranb2	A	G	3: 157,541,763	S193G	probably benign	Het

Other mutations in Cd109

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Cd109	APN	9	78616969	missense	probably damaging	1.00
IGL00465:Cd109	APN	9	78660934	nonsense	probably null
IGL00667:Cd109	APN	9	78684877	missense	probably damaging	0.99
IGL01432:Cd109	APN	9	78698123	missense	probably benign
IGL01795:Cd109	APN	9	78661765	splice site	probably benign
IGL02343:Cd109	APN	9	78688955	splice site	probably benign
IGL02450:Cd109	APN	9	78695850	missense	possibly damaging	0.83
IGL02699:Cd109	APN	9	78671989	splice site	probably benign
IGL02738:Cd109	APN	9	78691299	missense	probably damaging	1.00
IGL02797:Cd109	APN	9	78661713	missense	probably damaging	0.96
IGL03160:Cd109	APN	9	78661056	splice site	probably null
IGL03349:Cd109	APN	9	78636485	missense	probably benign	0.34
FR4589:Cd109	UTSW	9	78712529	critical splice acceptor site	probably benign
R0048:Cd109	UTSW	9	78680021	missense	possibly damaging	0.50
R0060:Cd109	UTSW	9	78703107	missense	probably damaging	1.00
R0060:Cd109	UTSW	9	78703107	missense	probably damaging	1.00
R0158:Cd109	UTSW	9	78688932	missense	possibly damaging	0.49
R0415:Cd109	UTSW	9	78712615	missense	probably benign	0.13
R0709:Cd109	UTSW	9	78671978	missense	possibly damaging	0.93
R0840:Cd109	UTSW	9	78664330	missense	probably benign	0.04
R0909:Cd109	UTSW	9	78636473	missense	probably benign	0.01
R0945:Cd109	UTSW	9	78688941	missense	possibly damaging	0.51
R1344:Cd109	UTSW	9	78672550	critical splice acceptor site	probably null
R1471:Cd109	UTSW	9	78654587	missense	probably damaging	1.00
R1484:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R1570:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R1688:Cd109	UTSW	9	78705091	missense	probably benign	0.17
R1773:Cd109	UTSW	9	78703724	missense	probably benign	0.21
R1813:Cd109	UTSW	9	78617005	missense	probably benign	0.04
R2004:Cd109	UTSW	9	78703762	missense	probably benign	0.00
R2083:Cd109	UTSW	9	78667293	missense	probably damaging	1.00
R2483:Cd109	UTSW	9	78667357	missense	probably damaging	1.00
R2857:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2858:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2859:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2911:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2912:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2914:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2927:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3623:Cd109	UTSW	9	78667357	missense	probably damaging	1.00
R3713:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3760:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3762:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3771:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3772:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3773:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3916:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3917:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4117:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4260:Cd109	UTSW	9	78636463	missense	possibly damaging	0.67
R4387:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4389:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4526:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4527:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4528:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4700:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4708:Cd109	UTSW	9	78672589	missense	probably benign	0.00
R4723:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4750:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4751:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4754:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4755:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4773:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4984:Cd109	UTSW	9	78634677	critical splice donor site	probably null
R5259:Cd109	UTSW	9	78710152	missense	probably benign	0.30
R5353:Cd109	UTSW	9	78710239	missense	probably damaging	1.00
R5440:Cd109	UTSW	9	78680164	critical splice donor site	probably null
R5559:Cd109	UTSW	9	78660968	missense	probably benign	0.01
R5701:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R5995:Cd109	UTSW	9	78700279	missense	probably benign	0.01
R5997:Cd109	UTSW	9	78705062	missense	possibly damaging	0.93
R6103:Cd109	UTSW	9	78698314	splice site	probably null
R6174:Cd109	UTSW	9	78665546	critical splice donor site	probably null
R6410:Cd109	UTSW	9	78657516	missense	probably benign	0.01
R6529:Cd109	UTSW	9	78712625	missense	probably damaging	1.00
R6655:Cd109	UTSW	9	78684938	missense	probably benign	0.44
R6704:Cd109	UTSW	9	78680075	missense	probably benign	0.01
R6772:Cd109	UTSW	9	78680810	missense	possibly damaging	0.55
R6817:Cd109	UTSW	9	78714955	missense	probably benign	0.01
R6903:Cd109	UTSW	9	78636603	missense	probably damaging	0.97
R7294:Cd109	UTSW	9	78712635	missense	probably damaging	0.97
R7432:Cd109	UTSW	9	78714943	missense	possibly damaging	0.85
R7566:Cd109	UTSW	9	78680837	missense	probably damaging	1.00
R7767:Cd109	UTSW	9	78710159	missense	probably damaging	1.00
R7986:Cd109	UTSW	9	78688766	missense	possibly damaging	0.95
R8017:Cd109	UTSW	9	78707546	missense	possibly damaging	0.81
R8019:Cd109	UTSW	9	78707546	missense	possibly damaging	0.81
R8050:Cd109	UTSW	9	78664351	missense	probably benign	0.28
R8225:Cd109	UTSW	9	78661690	missense	probably damaging	0.99
R8269:Cd109	UTSW	9	78665682	missense	probably benign	0.06
R8479:Cd109	UTSW	9	78667346	nonsense	probably null
R8493:Cd109	UTSW	9	78657519	missense	probably benign	0.41
R8781:Cd109	UTSW	9	78636647	missense	probably damaging	1.00
R8977:Cd109	UTSW	9	78707528	missense	probably benign	0.36
R9051:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R9051:Cd109	UTSW	9	78712531	critical splice acceptor site	probably benign
R9228:Cd109	UTSW	9	78669760	missense	possibly damaging	0.93
R9366:Cd109	UTSW	9	78714993	missense	probably benign	0.11
R9430:Cd109	UTSW	9	78667416	critical splice donor site	probably null
R9572:Cd109	UTSW	9	78660306	missense	probably benign	0.16
R9691:Cd109	UTSW	9	78703792	missense	possibly damaging	0.94
R9736:Cd109	UTSW	9	78712636	missense	probably damaging	1.00
R9749:Cd109	UTSW	9	78684884	missense	probably damaging	1.00
R9751:Cd109	UTSW	9	78698160	missense	probably damaging	0.99
R9752:Cd109	UTSW	9	78707552	missense	probably benign	0.00
R9789:Cd109	UTSW	9	78634662	missense	possibly damaging	0.90
R9797:Cd109	UTSW	9	78671935	missense	probably benign	0.04
RF002:Cd109	UTSW	9	78712523	critical splice acceptor site	probably benign
RF002:Cd109	UTSW	9	78712528	critical splice acceptor site	probably benign
RF003:Cd109	UTSW	9	78712531	critical splice acceptor site	probably benign
RF011:Cd109	UTSW	9	78712528	critical splice acceptor site	probably benign
RF013:Cd109	UTSW	9	78712531	critical splice acceptor site	probably benign
RF047:Cd109	UTSW	9	78712527	critical splice acceptor site	probably benign
RF060:Cd109	UTSW	9	78712525	critical splice acceptor site	probably benign
Z1177:Cd109	UTSW	9	78691313	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CATGGTCCATGTCTATTGCAGACGAT -3'
(R):5'- TAAAGCCTGTCACTCTCTCCTTGATGA -3'

Sequencing Primer
(F):5'- GTCTATTGCAGACGATACTGAAG -3'
(R):5'- TCCTTGATGATACTCTGTGGTC -3'

Posted On

2014-08-20