Incidental Mutation 'R0659:Hdac9'
ID218702
Institutional Source Beutler Lab
Gene Symbol Hdac9
Ensembl Gene ENSMUSG00000004698
Gene Namehistone deacetylase 9
SynonymsHdac7b, HDRP, Mitr, D030072B18Rik
MMRRC Submission 038844-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0659 (G1)
Quality Score24
Status Validated
Chromosome12
Chromosomal Location34047580-34917095 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34437222 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 60 (Q60R)
Ref Sequence ENSEMBL: ENSMUSP00000147903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110819] [ENSMUST00000209463] [ENSMUST00000209667] [ENSMUST00000209750] [ENSMUST00000209902] [ENSMUST00000209990] [ENSMUST00000210724] [ENSMUST00000211107] [ENSMUST00000211752]
Predicted Effect probably damaging
Transcript: ENSMUST00000110819
AA Change: Q60R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106443
Gene: ENSMUSG00000004698
AA Change: Q60R

DomainStartEndE-ValueType
Pfam:HDAC4_Gln 37 124 5.4e-36 PFAM
low complexity region 260 284 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
low complexity region 464 480 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209463
AA Change: Q60R

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000209667
AA Change: Q60R

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably damaging
Transcript: ENSMUST00000209750
AA Change: Q60R

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000209902
AA Change: Q60R

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209990
AA Change: Q60R

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000210724
AA Change: Q60R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211107
AA Change: Q29R

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211632
Predicted Effect probably damaging
Transcript: ENSMUST00000211752
AA Change: Q81R

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.0976 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene has sequence homology to members of the histone deacetylase family. This gene is orthologous to the Xenopus and mouse MITR genes. The MITR protein lacks the histone deacetylase catalytic domain. It represses MEF2 activity through recruitment of multicomponent corepressor complexes that include CtBP and HDACs. This encoded protein may play a role in hematopoiesis. Multiple alternatively spliced transcripts have been described for this gene but the full-length nature of some of them has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display age dependent cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A G 18: 59,007,493 probably benign Het
Ahnak A G 19: 9,015,002 H4550R possibly damaging Het
Anxa6 A G 11: 54,983,347 V591A probably damaging Het
Apol7c A G 15: 77,526,273 S158P probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
Cacna2d4 A G 6: 119,345,106 probably benign Het
Cd109 T C 9: 78,680,170 probably benign Het
Cep78 C T 19: 15,956,190 V675M probably damaging Het
Ces4a T C 8: 105,144,922 probably benign Het
Chpf A G 1: 75,477,723 V137A probably damaging Het
Comp T C 8: 70,379,101 S457P possibly damaging Het
Cth A G 3: 157,920,115 probably benign Het
Cyp2a12 T C 7: 27,034,138 L314P probably damaging Het
Ets1 C T 9: 32,738,293 R309C probably damaging Het
Fam208b T C 13: 3,574,448 D1834G probably damaging Het
Foxp2 T C 6: 15,254,279 probably benign Het
Gm9875 T G 2: 13,558,184 F108V unknown Het
Golga5 G T 12: 102,476,208 V269F possibly damaging Het
Greb1 T C 12: 16,680,212 Y1738C probably damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Hdac5 A T 11: 102,196,024 V70E probably damaging Het
Hsd17b3 T C 13: 64,073,936 T92A possibly damaging Het
Itpk1 C T 12: 102,606,078 probably benign Het
Lin28a T C 4: 134,008,099 probably benign Het
Mapk6 T C 9: 75,397,962 S58G probably damaging Het
Mmp21 G A 7: 133,677,667 probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mroh2a G A 1: 88,250,342 D1053N probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Mto1 T A 9: 78,457,508 I343N probably damaging Het
Mto1 C T 9: 78,470,790 T638M probably damaging Het
Myo18b T C 5: 112,760,327 K2027E possibly damaging Het
Myo7a T C 7: 98,054,338 probably benign Het
Nlrp9a T C 7: 26,557,278 I107T probably damaging Het
Olfr181 C A 16: 58,926,409 R54L possibly damaging Het
Olfr970 T G 9: 39,819,816 M59R possibly damaging Het
Osbpl5 A G 7: 143,705,030 S268P probably damaging Het
Pih1d1 T A 7: 45,159,975 S289T probably benign Het
Pik3c2b A G 1: 133,071,200 D353G probably damaging Het
Ppef2 A G 5: 92,230,509 L609P probably damaging Het
Prune2 A T 19: 17,122,835 D1901V probably damaging Het
Rdh9 T C 10: 127,776,575 Y31H possibly damaging Het
Slc5a9 T A 4: 111,883,871 Y526F possibly damaging Het
Slitrk5 A G 14: 111,680,689 K582E probably benign Het
Sult1c2 A T 17: 53,831,778 M257K probably damaging Het
Tmem132d A G 5: 127,984,287 I417T possibly damaging Het
Tmem229b T C 12: 78,965,134 T8A probably benign Het
Tmem237 T C 1: 59,114,094 I89M possibly damaging Het
Tnfrsf17 A T 16: 11,319,819 D140V probably damaging Het
Tnrc6b T A 15: 80,923,446 probably benign Het
Trio A G 15: 27,831,399 L194P probably damaging Het
Vmn2r74 T C 7: 85,955,914 probably benign Het
Vps13c T A 9: 67,920,935 M1457K probably benign Het
Zfhx2 A G 14: 55,073,801 C479R possibly damaging Het
Zfp420 T A 7: 29,875,539 C395S probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Zfp82 C T 7: 30,056,329 E443K probably damaging Het
Zranb2 A G 3: 157,541,763 S193G probably benign Het
Other mutations in Hdac9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Hdac9 APN 12 34429489 splice site probably benign
IGL01484:Hdac9 APN 12 34437165 missense probably damaging 1.00
IGL02010:Hdac9 APN 12 34431945 missense probably damaging 1.00
IGL02059:Hdac9 APN 12 34431968 missense probably damaging 0.97
IGL02276:Hdac9 APN 12 34431926 missense probably damaging 1.00
IGL02797:Hdac9 APN 12 34393274 splice site probably benign
IGL03202:Hdac9 APN 12 34373951 missense probably damaging 1.00
PIT4468001:Hdac9 UTSW 12 34095934 missense unknown
R0304:Hdac9 UTSW 12 34374111 missense probably damaging 1.00
R0432:Hdac9 UTSW 12 34437222 missense probably damaging 1.00
R1826:Hdac9 UTSW 12 34429492 splice site probably benign
R1879:Hdac9 UTSW 12 34390333 missense probably damaging 0.98
R1942:Hdac9 UTSW 12 34429545 missense probably damaging 1.00
R2113:Hdac9 UTSW 12 34389332 missense probably damaging 1.00
R2151:Hdac9 UTSW 12 34390256 missense probably damaging 1.00
R2216:Hdac9 UTSW 12 34429517 missense probably damaging 1.00
R2224:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R2225:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R2227:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R3500:Hdac9 UTSW 12 34437353 missense probably benign 0.01
R4441:Hdac9 UTSW 12 34389376 missense probably damaging 1.00
R4674:Hdac9 UTSW 12 34373960 missense possibly damaging 0.96
R4694:Hdac9 UTSW 12 34437247 missense probably damaging 1.00
R5033:Hdac9 UTSW 12 34373907 missense probably benign
R5229:Hdac9 UTSW 12 34437164 missense probably damaging 1.00
R5353:Hdac9 UTSW 12 34393393 nonsense probably null
R5384:Hdac9 UTSW 12 34429558 missense probably damaging 1.00
R5958:Hdac9 UTSW 12 34373883 missense probably damaging 0.97
R6129:Hdac9 UTSW 12 34287475 missense probably damaging 1.00
R6157:Hdac9 UTSW 12 34389429 missense probably damaging 1.00
R6248:Hdac9 UTSW 12 34528294 missense possibly damaging 0.79
R6333:Hdac9 UTSW 12 34052324 missense probably damaging 0.98
R6474:Hdac9 UTSW 12 34431991 critical splice acceptor site probably null
R6589:Hdac9 UTSW 12 34215029 missense probably damaging 1.00
R6737:Hdac9 UTSW 12 34215452 missense probably damaging 1.00
R6767:Hdac9 UTSW 12 34287529 missense probably damaging 1.00
R6837:Hdac9 UTSW 12 34287464 missense probably benign 0.12
R6857:Hdac9 UTSW 12 34393363 missense probably benign 0.37
R7069:Hdac9 UTSW 12 34429549 missense possibly damaging 0.92
R7237:Hdac9 UTSW 12 34374140 critical splice acceptor site probably null
R7768:Hdac9 UTSW 12 34390240 missense possibly damaging 0.81
Z1088:Hdac9 UTSW 12 34407789 missense probably damaging 1.00
Z1176:Hdac9 UTSW 12 34373987 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTATGGACCTGCCCAGTCTTGTG -3'
(R):5'- CTCCAGTGGACGTGAAATCAGAGG -3'

Sequencing Primer
(F):5'- CTTGGTGGTAACTATACAGGCAC -3'
(R):5'- ACGTGAAATCAGAGGTTCCTATG -3'
Posted On2014-08-20