Incidental Mutation 'R0659:Apol7c'
ID218704
Institutional Source Beutler Lab
Gene Symbol Apol7c
Ensembl Gene ENSMUSG00000044309
Gene Nameapolipoprotein L 7c
Synonyms
MMRRC Submission 038844-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0659 (G1)
Quality Score79
Status Validated
Chromosome15
Chromosomal Location77524852-77533316 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77526273 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 158 (S158P)
Ref Sequence ENSEMBL: ENSMUSP00000050745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062562] [ENSMUST00000230863]
Predicted Effect probably damaging
Transcript: ENSMUST00000062562
AA Change: S158P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000050745
Gene: ENSMUSG00000044309
AA Change: S158P

DomainStartEndE-ValueType
Pfam:ApoL 20 81 1.7e-12 PFAM
Pfam:ApoL 77 367 5.1e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230863
Meta Mutation Damage Score 0.8309 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.6%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A G 18: 59,007,493 probably benign Het
Ahnak A G 19: 9,015,002 H4550R possibly damaging Het
Anxa6 A G 11: 54,983,347 V591A probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
Cacna2d4 A G 6: 119,345,106 probably benign Het
Cd109 T C 9: 78,680,170 probably benign Het
Cep78 C T 19: 15,956,190 V675M probably damaging Het
Ces4a T C 8: 105,144,922 probably benign Het
Chpf A G 1: 75,477,723 V137A probably damaging Het
Comp T C 8: 70,379,101 S457P possibly damaging Het
Cth A G 3: 157,920,115 probably benign Het
Cyp2a12 T C 7: 27,034,138 L314P probably damaging Het
Ets1 C T 9: 32,738,293 R309C probably damaging Het
Fam208b T C 13: 3,574,448 D1834G probably damaging Het
Foxp2 T C 6: 15,254,279 probably benign Het
Gm9875 T G 2: 13,558,184 F108V unknown Het
Golga5 G T 12: 102,476,208 V269F possibly damaging Het
Greb1 T C 12: 16,680,212 Y1738C probably damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Hdac5 A T 11: 102,196,024 V70E probably damaging Het
Hdac9 T C 12: 34,437,222 Q60R probably damaging Het
Hsd17b3 T C 13: 64,073,936 T92A possibly damaging Het
Itpk1 C T 12: 102,606,078 probably benign Het
Lin28a T C 4: 134,008,099 probably benign Het
Mapk6 T C 9: 75,397,962 S58G probably damaging Het
Mmp21 G A 7: 133,677,667 probably benign Het
Mroh2a G A 1: 88,250,342 D1053N probably damaging Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Mto1 T A 9: 78,457,508 I343N probably damaging Het
Mto1 C T 9: 78,470,790 T638M probably damaging Het
Myo18b T C 5: 112,760,327 K2027E possibly damaging Het
Myo7a T C 7: 98,054,338 probably benign Het
Nlrp9a T C 7: 26,557,278 I107T probably damaging Het
Olfr181 C A 16: 58,926,409 R54L possibly damaging Het
Olfr970 T G 9: 39,819,816 M59R possibly damaging Het
Osbpl5 A G 7: 143,705,030 S268P probably damaging Het
Pih1d1 T A 7: 45,159,975 S289T probably benign Het
Pik3c2b A G 1: 133,071,200 D353G probably damaging Het
Ppef2 A G 5: 92,230,509 L609P probably damaging Het
Prune2 A T 19: 17,122,835 D1901V probably damaging Het
Rdh9 T C 10: 127,776,575 Y31H possibly damaging Het
Slc5a9 T A 4: 111,883,871 Y526F possibly damaging Het
Slitrk5 A G 14: 111,680,689 K582E probably benign Het
Sult1c2 A T 17: 53,831,778 M257K probably damaging Het
Tmem132d A G 5: 127,984,287 I417T possibly damaging Het
Tmem229b T C 12: 78,965,134 T8A probably benign Het
Tmem237 T C 1: 59,114,094 I89M possibly damaging Het
Tnfrsf17 A T 16: 11,319,819 D140V probably damaging Het
Tnrc6b T A 15: 80,923,446 probably benign Het
Trio A G 15: 27,831,399 L194P probably damaging Het
Vmn2r74 T C 7: 85,955,914 probably benign Het
Vps13c T A 9: 67,920,935 M1457K probably benign Het
Zfhx2 A G 14: 55,073,801 C479R possibly damaging Het
Zfp420 T A 7: 29,875,539 C395S probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Zfp82 C T 7: 30,056,329 E443K probably damaging Het
Zranb2 A G 3: 157,541,763 S193G probably benign Het
Other mutations in Apol7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Apol7c APN 15 77526437 missense probably damaging 1.00
IGL01653:Apol7c APN 15 77526300 missense probably damaging 1.00
IGL02169:Apol7c APN 15 77526416 missense possibly damaging 0.87
IGL02262:Apol7c APN 15 77525813 missense probably benign 0.20
IGL02375:Apol7c APN 15 77528849 missense probably damaging 0.98
IGL02645:Apol7c APN 15 77528883 missense probably benign 0.19
IGL02934:Apol7c APN 15 77526118 missense possibly damaging 0.51
IGL03127:Apol7c APN 15 77525906 missense probably benign 0.16
R0130:Apol7c UTSW 15 77526362 missense possibly damaging 0.52
R1638:Apol7c UTSW 15 77526218 missense probably damaging 0.97
R1980:Apol7c UTSW 15 77526044 missense probably benign 0.16
R4366:Apol7c UTSW 15 77526389 missense probably benign 0.07
R4466:Apol7c UTSW 15 77526464 missense probably benign 0.00
R4624:Apol7c UTSW 15 77526395 missense probably damaging 1.00
R4629:Apol7c UTSW 15 77526395 missense probably damaging 1.00
R4706:Apol7c UTSW 15 77525723 missense probably benign 0.05
R5367:Apol7c UTSW 15 77526147 missense probably damaging 1.00
R5586:Apol7c UTSW 15 77526399 missense possibly damaging 0.81
R6239:Apol7c UTSW 15 77526431 missense probably benign 0.28
R6860:Apol7c UTSW 15 77526074 missense probably benign 0.02
R7179:Apol7c UTSW 15 77525643 missense probably benign 0.01
R7234:Apol7c UTSW 15 77525675 nonsense probably null
R7513:Apol7c UTSW 15 77525711 missense possibly damaging 0.51
R7779:Apol7c UTSW 15 77525746 missense probably damaging 0.98
R8499:Apol7c UTSW 15 77526080 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCTGGGGCCACTCTGATCCAAAAC -3'
(R):5'- TTGAGTGAAGCCCTGACTGAGACC -3'

Sequencing Primer
(F):5'- CTGGCTTTAGCTTCAGCAGAC -3'
(R):5'- CTGACTGAGACCATAGCTGATACTG -3'
Posted On2014-08-20