Incidental Mutation 'R0659:Grin2a'
ID218705
Institutional Source Beutler Lab
Gene Symbol Grin2a
Ensembl Gene ENSMUSG00000059003
Gene Nameglutamate receptor, ionotropic, NMDA2A (epsilon 1)
SynonymsNR2A, GluRepsilon1, NMDAR2A, GluN2A
MMRRC Submission 038844-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock #R0659 (G1)
Quality Score70
Status Validated
Chromosome16
Chromosomal Location9567898-9995560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 9992472 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 21 (P21Q)
Ref Sequence ENSEMBL: ENSMUSP00000142900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032331] [ENSMUST00000115835] [ENSMUST00000199708]
Predicted Effect probably damaging
Transcript: ENSMUST00000032331
AA Change: P21Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032331
Gene: ENSMUSG00000059003
AA Change: P21Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:ANF_receptor 106 301 1.6e-10 PFAM
PBPe 431 798 1.68e-70 SMART
Lig_chan-Glu_bd 439 502 2.24e-22 SMART
transmembrane domain 818 837 N/A INTRINSIC
Pfam:NMDAR2_C 839 1464 2.1e-230 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115835
AA Change: P21Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111501
Gene: ENSMUSG00000059003
AA Change: P21Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:ANF_receptor 99 300 9.2e-11 PFAM
PBPe 431 798 1.68e-70 SMART
Lig_chan-Glu_bd 439 502 2.24e-22 SMART
transmembrane domain 818 837 N/A INTRINSIC
Pfam:NMDAR2_C 839 1464 1.2e-266 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197242
Predicted Effect probably damaging
Transcript: ENSMUST00000199708
AA Change: P21Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142900
Gene: ENSMUSG00000059003
AA Change: P21Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:ANF_receptor 106 301 1.6e-10 PFAM
PBPe 431 798 1.68e-70 SMART
Lig_chan-Glu_bd 439 502 2.24e-22 SMART
transmembrane domain 818 837 N/A INTRINSIC
Pfam:NMDAR2_C 839 1464 2.1e-230 PFAM
Meta Mutation Damage Score 0.0882 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.6%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutamate-gated ion channel protein family. The encoded protein is an N-methyl-D-aspartate (NMDA) receptor subunit. NMDA receptors are both ligand-gated and voltage-dependent, and are involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. These receptors are permeable to calcium ions, and activation results in a calcium influx into post-synaptic cells, which results in the activation of several signaling cascades. Disruption of this gene is associated with focal epilepsy and speech disorder with or without mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit jumpiness, mildly impaired long-term potentiation and spatial learning, increased locomotor activity and metabolism of dopamine and serotonin, and loss of analgesic tolerance after repeated morphine doses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A G 18: 59,007,493 probably benign Het
Ahnak A G 19: 9,015,002 H4550R possibly damaging Het
Anxa6 A G 11: 54,983,347 V591A probably damaging Het
Apol7c A G 15: 77,526,273 S158P probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
Cacna2d4 A G 6: 119,345,106 probably benign Het
Cd109 T C 9: 78,680,170 probably benign Het
Cep78 C T 19: 15,956,190 V675M probably damaging Het
Ces4a T C 8: 105,144,922 probably benign Het
Chpf A G 1: 75,477,723 V137A probably damaging Het
Comp T C 8: 70,379,101 S457P possibly damaging Het
Cth A G 3: 157,920,115 probably benign Het
Cyp2a12 T C 7: 27,034,138 L314P probably damaging Het
Ets1 C T 9: 32,738,293 R309C probably damaging Het
Fam208b T C 13: 3,574,448 D1834G probably damaging Het
Foxp2 T C 6: 15,254,279 probably benign Het
Gm9875 T G 2: 13,558,184 F108V unknown Het
Golga5 G T 12: 102,476,208 V269F possibly damaging Het
Greb1 T C 12: 16,680,212 Y1738C probably damaging Het
Hdac5 A T 11: 102,196,024 V70E probably damaging Het
Hdac9 T C 12: 34,437,222 Q60R probably damaging Het
Hsd17b3 T C 13: 64,073,936 T92A possibly damaging Het
Itpk1 C T 12: 102,606,078 probably benign Het
Lin28a T C 4: 134,008,099 probably benign Het
Mapk6 T C 9: 75,397,962 S58G probably damaging Het
Mmp21 G A 7: 133,677,667 probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mroh2a G A 1: 88,250,342 D1053N probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Mto1 T A 9: 78,457,508 I343N probably damaging Het
Mto1 C T 9: 78,470,790 T638M probably damaging Het
Myo18b T C 5: 112,760,327 K2027E possibly damaging Het
Myo7a T C 7: 98,054,338 probably benign Het
Nlrp9a T C 7: 26,557,278 I107T probably damaging Het
Olfr181 C A 16: 58,926,409 R54L possibly damaging Het
Olfr970 T G 9: 39,819,816 M59R possibly damaging Het
Osbpl5 A G 7: 143,705,030 S268P probably damaging Het
Pih1d1 T A 7: 45,159,975 S289T probably benign Het
Pik3c2b A G 1: 133,071,200 D353G probably damaging Het
Ppef2 A G 5: 92,230,509 L609P probably damaging Het
Prune2 A T 19: 17,122,835 D1901V probably damaging Het
Rdh9 T C 10: 127,776,575 Y31H possibly damaging Het
Slc5a9 T A 4: 111,883,871 Y526F possibly damaging Het
Slitrk5 A G 14: 111,680,689 K582E probably benign Het
Sult1c2 A T 17: 53,831,778 M257K probably damaging Het
Tmem132d A G 5: 127,984,287 I417T possibly damaging Het
Tmem229b T C 12: 78,965,134 T8A probably benign Het
Tmem237 T C 1: 59,114,094 I89M possibly damaging Het
Tnfrsf17 A T 16: 11,319,819 D140V probably damaging Het
Tnrc6b T A 15: 80,923,446 probably benign Het
Trio A G 15: 27,831,399 L194P probably damaging Het
Vmn2r74 T C 7: 85,955,914 probably benign Het
Vps13c T A 9: 67,920,935 M1457K probably benign Het
Zfhx2 A G 14: 55,073,801 C479R possibly damaging Het
Zfp420 T A 7: 29,875,539 C395S probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Zfp82 C T 7: 30,056,329 E443K probably damaging Het
Zranb2 A G 3: 157,541,763 S193G probably benign Het
Other mutations in Grin2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01777:Grin2a APN 16 9644130 missense probably benign 0.29
IGL03288:Grin2a APN 16 9669840 missense possibly damaging 0.85
IGL02796:Grin2a UTSW 16 9585108 missense possibly damaging 0.72
PIT4402001:Grin2a UTSW 16 9644199 missense possibly damaging 0.77
PIT4494001:Grin2a UTSW 16 9585096 missense probably damaging 0.98
R0055:Grin2a UTSW 16 9669807 missense probably damaging 0.99
R0055:Grin2a UTSW 16 9669807 missense probably damaging 0.99
R0164:Grin2a UTSW 16 9994821 critical splice donor site probably null
R0164:Grin2a UTSW 16 9994821 critical splice donor site probably null
R0211:Grin2a UTSW 16 9579173 missense possibly damaging 0.86
R0390:Grin2a UTSW 16 9579585 missense possibly damaging 0.85
R0661:Grin2a UTSW 16 9992472 missense probably damaging 0.98
R0734:Grin2a UTSW 16 9579611 missense possibly damaging 0.71
R1524:Grin2a UTSW 16 9663603 missense possibly damaging 0.55
R1542:Grin2a UTSW 16 9579203 missense probably damaging 0.98
R1556:Grin2a UTSW 16 9707715 missense probably benign 0.18
R1605:Grin2a UTSW 16 9663330 missense possibly damaging 0.46
R1792:Grin2a UTSW 16 9992395 missense possibly damaging 0.53
R2024:Grin2a UTSW 16 9644243 missense possibly damaging 0.76
R2057:Grin2a UTSW 16 9669744 missense probably benign 0.14
R2344:Grin2a UTSW 16 9663235 missense probably benign 0.03
R2847:Grin2a UTSW 16 9761965 missense possibly damaging 0.73
R2848:Grin2a UTSW 16 9761965 missense possibly damaging 0.73
R2981:Grin2a UTSW 16 9644223 missense possibly damaging 0.89
R4197:Grin2a UTSW 16 9761967 missense probably damaging 1.00
R4342:Grin2a UTSW 16 9653589 missense possibly damaging 0.52
R4741:Grin2a UTSW 16 9663512 missense probably damaging 1.00
R4891:Grin2a UTSW 16 9657706 missense possibly damaging 0.51
R4925:Grin2a UTSW 16 9669823 missense probably damaging 0.98
R5563:Grin2a UTSW 16 9707717 missense probably benign 0.18
R5645:Grin2a UTSW 16 9992226 missense probably damaging 0.98
R5769:Grin2a UTSW 16 9761526 missense possibly damaging 0.89
R5885:Grin2a UTSW 16 9761905 missense possibly damaging 0.95
R6065:Grin2a UTSW 16 9761907 missense possibly damaging 0.92
R6083:Grin2a UTSW 16 9579540 missense probably benign 0.02
R6137:Grin2a UTSW 16 9653449 missense probably benign 0.32
R6286:Grin2a UTSW 16 9761775 missense possibly damaging 0.93
R6342:Grin2a UTSW 16 9579334 missense probably damaging 0.98
R6697:Grin2a UTSW 16 9669840 missense possibly damaging 0.85
R6924:Grin2a UTSW 16 9663228 missense possibly damaging 0.71
R7070:Grin2a UTSW 16 9579424 missense possibly damaging 0.92
R7235:Grin2a UTSW 16 9579265 missense probably damaging 0.98
R7274:Grin2a UTSW 16 9579122 missense possibly damaging 0.71
R7669:Grin2a UTSW 16 9992463 missense probably benign
X0024:Grin2a UTSW 16 9663199 missense probably benign 0.36
Z1177:Grin2a UTSW 16 9663577 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TGCCATTTGTAGAACAACCCCTCC -3'
(R):5'- TTTCACATTCGACTCTCAGAGCGG -3'

Sequencing Primer
(F):5'- ATGAGGTCGCACACATGC -3'
(R):5'- GGTGCAGGGGCAGTCTATC -3'
Posted On2014-08-20