Incidental Mutation 'R0689:Sox6'
ID218717
Institutional Source Beutler Lab
Gene Symbol Sox6
Ensembl Gene ENSMUSG00000051910
Gene NameSRY (sex determining region Y)-box 6
Synonyms
MMRRC Submission 038874-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0689 (G1)
Quality Score65
Status Validated
Chromosome7
Chromosomal Location115470872-116038796 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115486551 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 685 (V685A)
Ref Sequence ENSEMBL: ENSMUSP00000145919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072804] [ENSMUST00000106612] [ENSMUST00000166207] [ENSMUST00000166877] [ENSMUST00000169129] [ENSMUST00000205405] [ENSMUST00000206034] [ENSMUST00000206369]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072804
AA Change: V726A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072583
Gene: ENSMUSG00000051910
AA Change: V726A

DomainStartEndE-ValueType
coiled coil region 184 261 N/A INTRINSIC
low complexity region 462 484 N/A INTRINSIC
low complexity region 507 517 N/A INTRINSIC
HMG 619 689 1.5e-25 SMART
low complexity region 797 809 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106612
AA Change: V684A

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102223
Gene: ENSMUSG00000051910
AA Change: V684A

DomainStartEndE-ValueType
coiled coil region 184 261 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
low complexity region 420 442 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
HMG 577 647 1.5e-25 SMART
low complexity region 755 767 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166207
AA Change: V726A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129027
Gene: ENSMUSG00000051910
AA Change: V726A

DomainStartEndE-ValueType
coiled coil region 184 261 N/A INTRINSIC
low complexity region 462 484 N/A INTRINSIC
low complexity region 507 517 N/A INTRINSIC
HMG 619 689 1.5e-25 SMART
low complexity region 797 809 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166877
AA Change: V686A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129512
Gene: ENSMUSG00000051910
AA Change: V686A

DomainStartEndE-ValueType
coiled coil region 184 263 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
low complexity region 422 444 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
HMG 579 649 1.5e-25 SMART
low complexity region 757 769 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169129
AA Change: V686A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126404
Gene: ENSMUSG00000051910
AA Change: V686A

DomainStartEndE-ValueType
coiled coil region 184 263 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
low complexity region 422 444 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
HMG 579 649 1.5e-25 SMART
low complexity region 757 769 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000205405
AA Change: V727A

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000206034
AA Change: V685A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000206369
AA Change: V727A

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.1677 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: This gene encodes a member of a family of transcriptional regulators containing high mobility group (HMG) DNA-binding domains. Function of the encoded protein is important for proper cardiac and skeletal development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygotes for null mutations exhibit cardioskeletal myopathy, cardiac blockage, delayed growth, and early postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 C A 7: 28,897,049 G674W probably damaging Het
Adcy9 A G 16: 4,312,804 probably benign Het
Adgrv1 C T 13: 81,475,105 V3800I possibly damaging Het
Agl A G 3: 116,793,628 Y93H probably damaging Het
Aldh1a3 T A 7: 66,402,005 D400V probably benign Het
Bpifc A G 10: 85,960,547 probably benign Het
Cachd1 G T 4: 100,974,876 R745L probably damaging Het
Cadm3 T A 1: 173,344,452 T185S possibly damaging Het
Cep85l G T 10: 53,348,847 D215E probably damaging Het
Ces1g A G 8: 93,328,407 S221P probably damaging Het
Cfap206 C T 4: 34,722,668 V138M probably benign Het
Csmd3 A T 15: 47,756,025 F1714I probably benign Het
Cyp4f18 A G 8: 71,995,968 L279P probably benign Het
Dnah7a G A 1: 53,620,681 Q723* probably null Het
Dnaja2 A G 8: 85,546,718 probably benign Het
Dnajc6 T C 4: 101,611,253 V162A possibly damaging Het
Dok4 T C 8: 94,870,919 T3A probably benign Het
Efcab7 T C 4: 99,904,784 W424R probably damaging Het
Fah A T 7: 84,593,184 probably null Het
Fam120a T C 13: 48,967,638 D64G probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gas8 T G 8: 123,524,106 L106R probably damaging Het
Gykl1 T G 18: 52,694,051 N110K possibly damaging Het
Hsd3b3 G T 3: 98,741,979 L343I possibly damaging Het
Itch T A 2: 155,182,178 S234T possibly damaging Het
Itgbl1 A T 14: 123,827,847 I61F possibly damaging Het
Klf6 T A 13: 5,865,116 S185T probably damaging Het
Klk1b1 A C 7: 43,970,719 K202T probably benign Het
Liph T C 16: 21,968,068 Y268C probably damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Myo9b G A 8: 71,330,756 D574N probably damaging Het
Nfyb G A 10: 82,755,002 A65V possibly damaging Het
Nipbl A G 15: 8,293,078 probably null Het
Olfm3 T A 3: 115,122,545 N355K probably benign Het
Olfr726 A T 14: 50,084,232 F150I probably benign Het
Pcdhb21 A G 18: 37,515,317 T500A probably benign Het
Pclo A G 5: 14,714,019 I4169V unknown Het
Pde4d T C 13: 109,740,544 S144P possibly damaging Het
Pgghg T C 7: 140,943,278 Y157H probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pla2g12a T C 3: 129,881,298 probably null Het
Ppp1r14d T C 2: 119,229,612 D63G probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgip1 A T 4: 102,966,252 D690V probably damaging Het
Skp1a T C 11: 52,243,765 probably benign Het
Slc25a12 T C 2: 71,311,493 Y272C possibly damaging Het
Slc37a2 A G 9: 37,235,550 probably benign Het
Snx6 A T 12: 54,763,656 S112T probably benign Het
Taf2 A T 15: 55,063,065 V163E possibly damaging Het
Tg A T 15: 66,839,404 probably benign Het
Tmem30c A G 16: 57,270,173 Y224H probably damaging Het
Tmem45b T C 9: 31,428,583 N173D probably benign Het
Traf5 T C 1: 191,997,876 T405A probably benign Het
Trerf1 C T 17: 47,319,374 noncoding transcript Het
Triobp A T 15: 78,959,988 K135* probably null Het
Ttll9 T A 2: 152,983,127 D75E probably benign Het
Vmn1r63 T C 7: 5,803,610 I8V probably benign Het
Vmn2r77 A T 7: 86,811,664 I733F probably damaging Het
Vmn2r98 T C 17: 19,080,520 S595P possibly damaging Het
Zcchc2 C T 1: 106,030,504 Q504* probably null Het
Zfp2 T C 11: 50,900,907 D103G probably benign Het
Zfp59 A G 7: 27,853,717 K198R probably benign Het
Zfp64 C A 2: 168,935,201 probably benign Het
Other mutations in Sox6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Sox6 APN 7 115477206 missense probably benign
IGL00957:Sox6 APN 7 115777092 missense probably damaging 1.00
IGL01624:Sox6 APN 7 115476968 missense probably damaging 1.00
IGL02057:Sox6 APN 7 115550075 missense probably damaging 1.00
IGL02385:Sox6 APN 7 115550039 missense possibly damaging 0.77
IGL02410:Sox6 APN 7 115486744 missense probably damaging 1.00
IGL02736:Sox6 APN 7 115580640 missense probably damaging 1.00
IGL02747:Sox6 APN 7 115489746 missense probably damaging 1.00
IGL02792:Sox6 APN 7 115541649 missense probably benign
PIT4480001:Sox6 UTSW 7 115597509 missense probably benign 0.03
R0458:Sox6 UTSW 7 115489794 missense probably damaging 1.00
R0800:Sox6 UTSW 7 115579014 critical splice donor site probably null
R1220:Sox6 UTSW 7 115662442 missense probably damaging 1.00
R1474:Sox6 UTSW 7 115701691 splice site probably benign
R1547:Sox6 UTSW 7 115701722 missense possibly damaging 0.93
R1570:Sox6 UTSW 7 115777123 missense probably damaging 1.00
R1674:Sox6 UTSW 7 115801419 missense probably benign 0.00
R1704:Sox6 UTSW 7 115476948 missense possibly damaging 0.92
R1754:Sox6 UTSW 7 115477055 missense probably benign
R1833:Sox6 UTSW 7 115777093 missense probably damaging 1.00
R1868:Sox6 UTSW 7 115659538 missense possibly damaging 0.89
R1893:Sox6 UTSW 7 115544568 missense probably benign 0.28
R2386:Sox6 UTSW 7 115597505 missense probably damaging 1.00
R2431:Sox6 UTSW 7 115550007 splice site probably null
R4303:Sox6 UTSW 7 115544469 critical splice donor site probably null
R4319:Sox6 UTSW 7 115580563 critical splice donor site probably null
R4320:Sox6 UTSW 7 115580563 critical splice donor site probably null
R4321:Sox6 UTSW 7 115580563 critical splice donor site probably null
R4323:Sox6 UTSW 7 115580563 critical splice donor site probably null
R4335:Sox6 UTSW 7 115512724 missense probably benign
R4567:Sox6 UTSW 7 115662322 missense probably benign 0.26
R4776:Sox6 UTSW 7 115541670 missense probably damaging 1.00
R4838:Sox6 UTSW 7 115486662 missense probably damaging 1.00
R4914:Sox6 UTSW 7 115476964 missense probably damaging 1.00
R4915:Sox6 UTSW 7 115476964 missense probably damaging 1.00
R5184:Sox6 UTSW 7 115777228 missense probably damaging 1.00
R5372:Sox6 UTSW 7 115550151 nonsense probably null
R5454:Sox6 UTSW 7 115701773 missense possibly damaging 0.89
R5663:Sox6 UTSW 7 115550054 missense probably benign
R5685:Sox6 UTSW 7 115579157 splice site probably null
R5734:Sox6 UTSW 7 115541621 critical splice donor site probably null
R6020:Sox6 UTSW 7 115486628 missense probably damaging 1.00
R6211:Sox6 UTSW 7 115801462 missense probably damaging 1.00
R6263:Sox6 UTSW 7 115477060 missense probably damaging 1.00
R6549:Sox6 UTSW 7 115486692 missense possibly damaging 0.79
R6576:Sox6 UTSW 7 115701702 missense probably damaging 0.96
R6680:Sox6 UTSW 7 115476983 missense possibly damaging 0.94
R6709:Sox6 UTSW 7 115701789 splice site probably null
R6747:Sox6 UTSW 7 115541731 missense probably damaging 1.00
R6755:Sox6 UTSW 7 115662442 missense probably damaging 0.99
R7233:Sox6 UTSW 7 115489809 missense possibly damaging 0.80
R7423:Sox6 UTSW 7 115550023 missense probably benign 0.30
R7455:Sox6 UTSW 7 115489669 missense probably benign 0.02
R7522:Sox6 UTSW 7 115801578 missense probably damaging 1.00
R7527:Sox6 UTSW 7 115777173 missense probably benign 0.00
R7852:Sox6 UTSW 7 115801604 start codon destroyed probably null 1.00
R7936:Sox6 UTSW 7 115544595 missense probably benign
R8278:Sox6 UTSW 7 115476964 missense probably damaging 1.00
R8335:Sox6 UTSW 7 115701714 missense probably damaging 1.00
R8558:Sox6 UTSW 7 115541798 missense probably benign 0.12
R8682:Sox6 UTSW 7 115476956 missense probably damaging 1.00
R8693:Sox6 UTSW 7 115662397 missense probably damaging 0.99
R8712:Sox6 UTSW 7 115597508 missense probably benign 0.00
X0061:Sox6 UTSW 7 115477148 missense probably benign 0.00
X0065:Sox6 UTSW 7 115550108 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGAAGCCCAGTTGTAGGTTGGTG -3'
(R):5'- TGGCTCTGTGGTTCAGAGGACAAG -3'

Sequencing Primer
(F):5'- GGTACAGCAGAGTCCCATAGTC -3'
(R):5'- CTGGAAGGTGTCACCATCCTTG -3'
Posted On2014-08-20