Mutagenetix > Incidental Mutation

Incidental Mutation 'R0689:Sox6'

218717

Institutional Source

Beutler Lab

Gene Symbol

Sox6

Ensembl Gene

ENSMUSG00000051910

Gene Name

SRY (sex determining region Y)-box 6

Synonyms

MMRRC Submission

038874-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0689 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

115470872-116038796 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 115486551 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 685 (V685A)

Ref Sequence

ENSEMBL: ENSMUSP00000145919 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072804] [ENSMUST00000106612] [ENSMUST00000166207] [ENSMUST00000166877] [ENSMUST00000169129] [ENSMUST00000205405] [ENSMUST00000206034] [ENSMUST00000206369]

AlphaFold

P40645

Predicted Effect

possibly damaging
Transcript: ENSMUST00000072804
AA Change: V726A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000072583
Gene: ENSMUSG00000051910
AA Change: V726A

Domain	Start	End	E-Value	Type
coiled coil region	184	261	N/A	INTRINSIC
low complexity region	462	484	N/A	INTRINSIC
low complexity region	507	517	N/A	INTRINSIC
HMG	619	689	1.5e-25	SMART
low complexity region	797	809	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106612
AA Change: V684A

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000102223
Gene: ENSMUSG00000051910
AA Change: V684A

Domain	Start	End	E-Value	Type
coiled coil region	184	261	N/A	INTRINSIC
low complexity region	323	333	N/A	INTRINSIC
low complexity region	420	442	N/A	INTRINSIC
low complexity region	465	475	N/A	INTRINSIC
HMG	577	647	1.5e-25	SMART
low complexity region	755	767	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166207
AA Change: V726A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000129027
Gene: ENSMUSG00000051910
AA Change: V726A

Domain	Start	End	E-Value	Type
coiled coil region	184	261	N/A	INTRINSIC
low complexity region	462	484	N/A	INTRINSIC
low complexity region	507	517	N/A	INTRINSIC
HMG	619	689	1.5e-25	SMART
low complexity region	797	809	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166877
AA Change: V686A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000129512
Gene: ENSMUSG00000051910
AA Change: V686A

Domain	Start	End	E-Value	Type
coiled coil region	184	263	N/A	INTRINSIC
low complexity region	324	335	N/A	INTRINSIC
low complexity region	422	444	N/A	INTRINSIC
low complexity region	467	477	N/A	INTRINSIC
HMG	579	649	1.5e-25	SMART
low complexity region	757	769	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169129
AA Change: V686A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000126404
Gene: ENSMUSG00000051910
AA Change: V686A

Domain	Start	End	E-Value	Type
coiled coil region	184	263	N/A	INTRINSIC
low complexity region	324	335	N/A	INTRINSIC
low complexity region	422	444	N/A	INTRINSIC
low complexity region	467	477	N/A	INTRINSIC
HMG	579	649	1.5e-25	SMART
low complexity region	757	769	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000205405
AA Change: V727A

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206034
AA Change: V685A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206369
AA Change: V727A

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)

Meta Mutation Damage Score

0.1677

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.4%
20x: 91.1%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: This gene encodes a member of a family of transcriptional regulators containing high mobility group (HMG) DNA-binding domains. Function of the encoded protein is important for proper cardiac and skeletal development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygotes for null mutations exhibit cardioskeletal myopathy, cardiac blockage, delayed growth, and early postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn4	C	A	7: 28,897,049	G674W	probably damaging	Het
Adcy9	A	G	16: 4,312,804		probably benign	Het
Adgrv1	C	T	13: 81,475,105	V3800I	possibly damaging	Het
Agl	A	G	3: 116,793,628	Y93H	probably damaging	Het
Aldh1a3	T	A	7: 66,402,005	D400V	probably benign	Het
Bpifc	A	G	10: 85,960,547		probably benign	Het
Cachd1	G	T	4: 100,974,876	R745L	probably damaging	Het
Cadm3	T	A	1: 173,344,452	T185S	possibly damaging	Het
Cep85l	G	T	10: 53,348,847	D215E	probably damaging	Het
Ces1g	A	G	8: 93,328,407	S221P	probably damaging	Het
Cfap206	C	T	4: 34,722,668	V138M	probably benign	Het
Csmd3	A	T	15: 47,756,025	F1714I	probably benign	Het
Cyp4f18	A	G	8: 71,995,968	L279P	probably benign	Het
Dnah7a	G	A	1: 53,620,681	Q723*	probably null	Het
Dnaja2	A	G	8: 85,546,718		probably benign	Het
Dnajc6	T	C	4: 101,611,253	V162A	possibly damaging	Het
Dok4	T	C	8: 94,870,919	T3A	probably benign	Het
Efcab7	T	C	4: 99,904,784	W424R	probably damaging	Het
Fah	A	T	7: 84,593,184		probably null	Het
Fam120a	T	C	13: 48,967,638	D64G	probably damaging	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gas8	T	G	8: 123,524,106	L106R	probably damaging	Het
Gykl1	T	G	18: 52,694,051	N110K	possibly damaging	Het
Hsd3b3	G	T	3: 98,741,979	L343I	possibly damaging	Het
Itch	T	A	2: 155,182,178	S234T	possibly damaging	Het
Itgbl1	A	T	14: 123,827,847	I61F	possibly damaging	Het
Klf6	T	A	13: 5,865,116	S185T	probably damaging	Het
Klk1b1	A	C	7: 43,970,719	K202T	probably benign	Het
Liph	T	C	16: 21,968,068	Y268C	probably damaging	Het
Mroh2a	C	T	1: 88,230,680	R150*	probably null	Het
Mroh2a	A	G	1: 88,258,664	S64G	probably benign	Het
Myo9b	G	A	8: 71,330,756	D574N	probably damaging	Het
Nfyb	G	A	10: 82,755,002	A65V	possibly damaging	Het
Nipbl	A	G	15: 8,293,078		probably null	Het
Olfm3	T	A	3: 115,122,545	N355K	probably benign	Het
Olfr726	A	T	14: 50,084,232	F150I	probably benign	Het
Pcdhb21	A	G	18: 37,515,317	T500A	probably benign	Het
Pclo	A	G	5: 14,714,019	I4169V	unknown	Het
Pde4d	T	C	13: 109,740,544	S144P	possibly damaging	Het
Pgghg	T	C	7: 140,943,278	Y157H	probably benign	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Pla2g12a	T	C	3: 129,881,298		probably null	Het
Ppp1r14d	T	C	2: 119,229,612	D63G	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Sgip1	A	T	4: 102,966,252	D690V	probably damaging	Het
Skp1a	T	C	11: 52,243,765		probably benign	Het
Slc25a12	T	C	2: 71,311,493	Y272C	possibly damaging	Het
Slc37a2	A	G	9: 37,235,550		probably benign	Het
Snx6	A	T	12: 54,763,656	S112T	probably benign	Het
Taf2	A	T	15: 55,063,065	V163E	possibly damaging	Het
Tg	A	T	15: 66,839,404		probably benign	Het
Tmem30c	A	G	16: 57,270,173	Y224H	probably damaging	Het
Tmem45b	T	C	9: 31,428,583	N173D	probably benign	Het
Traf5	T	C	1: 191,997,876	T405A	probably benign	Het
Trerf1	C	T	17: 47,319,374		noncoding transcript	Het
Triobp	A	T	15: 78,959,988	K135*	probably null	Het
Ttll9	T	A	2: 152,983,127	D75E	probably benign	Het
Vmn1r63	T	C	7: 5,803,610	I8V	probably benign	Het
Vmn2r77	A	T	7: 86,811,664	I733F	probably damaging	Het
Vmn2r98	T	C	17: 19,080,520	S595P	possibly damaging	Het
Zcchc2	C	T	1: 106,030,504	Q504*	probably null	Het
Zfp2	T	C	11: 50,900,907	D103G	probably benign	Het
Zfp59	A	G	7: 27,853,717	K198R	probably benign	Het
Zfp64	C	A	2: 168,935,201		probably benign	Het

Other mutations in Sox6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Sox6	APN	7	115477206	missense	probably benign
IGL00957:Sox6	APN	7	115777092	missense	probably damaging	1.00
IGL01624:Sox6	APN	7	115476968	missense	probably damaging	1.00
IGL02057:Sox6	APN	7	115550075	missense	probably damaging	1.00
IGL02385:Sox6	APN	7	115550039	missense	possibly damaging	0.77
IGL02410:Sox6	APN	7	115486744	missense	probably damaging	1.00
IGL02736:Sox6	APN	7	115580640	missense	probably damaging	1.00
IGL02747:Sox6	APN	7	115489746	missense	probably damaging	1.00
IGL02792:Sox6	APN	7	115541649	missense	probably benign
PIT4480001:Sox6	UTSW	7	115597509	missense	probably benign	0.03
R0458:Sox6	UTSW	7	115489794	missense	probably damaging	1.00
R0800:Sox6	UTSW	7	115579014	critical splice donor site	probably null
R1220:Sox6	UTSW	7	115662442	missense	probably damaging	1.00
R1474:Sox6	UTSW	7	115701691	splice site	probably benign
R1547:Sox6	UTSW	7	115701722	missense	possibly damaging	0.93
R1570:Sox6	UTSW	7	115777123	missense	probably damaging	1.00
R1674:Sox6	UTSW	7	115801419	missense	probably benign	0.00
R1704:Sox6	UTSW	7	115476948	missense	possibly damaging	0.92
R1754:Sox6	UTSW	7	115477055	missense	probably benign
R1833:Sox6	UTSW	7	115777093	missense	probably damaging	1.00
R1868:Sox6	UTSW	7	115659538	missense	possibly damaging	0.89
R1893:Sox6	UTSW	7	115544568	missense	probably benign	0.28
R2386:Sox6	UTSW	7	115597505	missense	probably damaging	1.00
R2431:Sox6	UTSW	7	115550007	splice site	probably null
R4303:Sox6	UTSW	7	115544469	critical splice donor site	probably null
R4319:Sox6	UTSW	7	115580563	critical splice donor site	probably null
R4320:Sox6	UTSW	7	115580563	critical splice donor site	probably null
R4321:Sox6	UTSW	7	115580563	critical splice donor site	probably null
R4323:Sox6	UTSW	7	115580563	critical splice donor site	probably null
R4335:Sox6	UTSW	7	115512724	missense	probably benign
R4567:Sox6	UTSW	7	115662322	missense	probably benign	0.26
R4776:Sox6	UTSW	7	115541670	missense	probably damaging	1.00
R4838:Sox6	UTSW	7	115486662	missense	probably damaging	1.00
R4914:Sox6	UTSW	7	115476964	missense	probably damaging	1.00
R4915:Sox6	UTSW	7	115476964	missense	probably damaging	1.00
R5184:Sox6	UTSW	7	115777228	missense	probably damaging	1.00
R5372:Sox6	UTSW	7	115550151	nonsense	probably null
R5454:Sox6	UTSW	7	115701773	missense	possibly damaging	0.89
R5663:Sox6	UTSW	7	115550054	missense	probably benign
R5685:Sox6	UTSW	7	115579157	splice site	probably null
R5734:Sox6	UTSW	7	115541621	critical splice donor site	probably null
R6020:Sox6	UTSW	7	115486628	missense	probably damaging	1.00
R6211:Sox6	UTSW	7	115801462	missense	probably damaging	1.00
R6263:Sox6	UTSW	7	115477060	missense	probably damaging	1.00
R6549:Sox6	UTSW	7	115486692	missense	possibly damaging	0.79
R6576:Sox6	UTSW	7	115701702	missense	probably damaging	0.96
R6680:Sox6	UTSW	7	115476983	missense	possibly damaging	0.94
R6709:Sox6	UTSW	7	115701789	splice site	probably null
R6747:Sox6	UTSW	7	115541731	missense	probably damaging	1.00
R6755:Sox6	UTSW	7	115662442	missense	probably damaging	0.99
R7233:Sox6	UTSW	7	115489809	missense	possibly damaging	0.80
R7423:Sox6	UTSW	7	115550023	missense	probably benign	0.30
R7455:Sox6	UTSW	7	115489669	missense	probably benign	0.02
R7522:Sox6	UTSW	7	115801578	missense	probably damaging	1.00
R7527:Sox6	UTSW	7	115777173	missense	probably benign	0.00
R7852:Sox6	UTSW	7	115801604	start codon destroyed	probably null	1.00
R7936:Sox6	UTSW	7	115544595	missense	probably benign
R8278:Sox6	UTSW	7	115476964	missense	probably damaging	1.00
R8335:Sox6	UTSW	7	115701714	missense	probably damaging	1.00
R8558:Sox6	UTSW	7	115541798	missense	probably benign	0.12
R8682:Sox6	UTSW	7	115476956	missense	probably damaging	1.00
R8693:Sox6	UTSW	7	115662397	missense	probably damaging	0.99
R8712:Sox6	UTSW	7	115597508	missense	probably benign	0.00
R8972:Sox6	UTSW	7	115476983	nonsense	probably null
R9297:Sox6	UTSW	7	115662322	missense	probably benign	0.26
R9318:Sox6	UTSW	7	115662322	missense	probably benign	0.26
R9517:Sox6	UTSW	7	115512735	missense	possibly damaging	0.79
R9688:Sox6	UTSW	7	115476990	missense	probably benign
X0061:Sox6	UTSW	7	115477148	missense	probably benign	0.00
X0065:Sox6	UTSW	7	115550108	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGAAGCCCAGTTGTAGGTTGGTG -3'
(R):5'- TGGCTCTGTGGTTCAGAGGACAAG -3'

Sequencing Primer
(F):5'- GGTACAGCAGAGTCCCATAGTC -3'
(R):5'- CTGGAAGGTGTCACCATCCTTG -3'

Posted On

2014-08-20