Mutagenetix > Incidental Mutation

Incidental Mutation 'R0689:Nipbl'

218723

Institutional Source

Beutler Lab

Gene Symbol

Nipbl

Ensembl Gene

ENSMUSG00000022141

Gene Name

NIPBL cohesin loading factor

Synonyms

4933421G18Rik, 4921518A06Rik

MMRRC Submission

038874-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R0689 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

8320101-8473947 bp(-) (GRCm39)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

A to G at 8322562 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000059385 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052965]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000052965

SMART Domains

Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141

Domain	Start	End	E-Value	Type
low complexity region	22	41	N/A	INTRINSIC
low complexity region	322	338	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	447	462	N/A	INTRINSIC
low complexity region	473	490	N/A	INTRINSIC
low complexity region	639	652	N/A	INTRINSIC
low complexity region	1020	1037	N/A	INTRINSIC
low complexity region	1081	1097	N/A	INTRINSIC
low complexity region	1102	1107	N/A	INTRINSIC
low complexity region	1114	1139	N/A	INTRINSIC
low complexity region	1165	1176	N/A	INTRINSIC
low complexity region	1389	1396	N/A	INTRINSIC
low complexity region	1577	1586	N/A	INTRINSIC
coiled coil region	1628	1656	N/A	INTRINSIC
Pfam:Cohesin_HEAT	1788	1829	1.1e-14	PFAM
Pfam:Nipped-B_C	2269	2450	2.8e-68	PFAM
low complexity region	2477	2501	N/A	INTRINSIC
low complexity region	2502	2512	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC
low complexity region	2626	2632	N/A	INTRINSIC
low complexity region	2660	2684	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.4%
20x: 91.1%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn4	C	A	7: 28,596,474 (GRCm39)	G674W	probably damaging	Het
Adcy9	A	G	16: 4,130,668 (GRCm39)		probably benign	Het
Adgrv1	C	T	13: 81,623,224 (GRCm39)	V3800I	possibly damaging	Het
Agl	A	G	3: 116,587,277 (GRCm39)	Y93H	probably damaging	Het
Aldh1a3	T	A	7: 66,051,753 (GRCm39)	D400V	probably benign	Het
Bpifc	A	G	10: 85,796,411 (GRCm39)		probably benign	Het
Cachd1	G	T	4: 100,832,073 (GRCm39)	R745L	probably damaging	Het
Cadm3	T	A	1: 173,172,019 (GRCm39)	T185S	possibly damaging	Het
Cep85l	G	T	10: 53,224,943 (GRCm39)	D215E	probably damaging	Het
Ces1g	A	G	8: 94,055,035 (GRCm39)	S221P	probably damaging	Het
Cfap206	C	T	4: 34,722,668 (GRCm39)	V138M	probably benign	Het
Csmd3	A	T	15: 47,619,421 (GRCm39)	F1714I	probably benign	Het
Cyp4f18	A	G	8: 72,749,812 (GRCm39)	L279P	probably benign	Het
Dnah7a	G	A	1: 53,659,840 (GRCm39)	Q723*	probably null	Het
Dnaja2	A	G	8: 86,273,347 (GRCm39)		probably benign	Het
Dnajc6	T	C	4: 101,468,450 (GRCm39)	V162A	possibly damaging	Het
Dok4	T	C	8: 95,597,547 (GRCm39)	T3A	probably benign	Het
Efcab7	T	C	4: 99,761,981 (GRCm39)	W424R	probably damaging	Het
Fah	A	T	7: 84,242,392 (GRCm39)		probably null	Het
Fam120a	T	C	13: 49,121,114 (GRCm39)	D64G	probably damaging	Het
G3bp1	T	C	11: 55,389,452 (GRCm39)	F383L	probably damaging	Het
Gas8	T	G	8: 124,250,845 (GRCm39)	L106R	probably damaging	Het
Gykl1	T	G	18: 52,827,123 (GRCm39)	N110K	possibly damaging	Het
Hsd3b3	G	T	3: 98,649,295 (GRCm39)	L343I	possibly damaging	Het
Itch	T	A	2: 155,024,098 (GRCm39)	S234T	possibly damaging	Het
Itgbl1	A	T	14: 124,065,259 (GRCm39)	I61F	possibly damaging	Het
Klf6	T	A	13: 5,915,115 (GRCm39)	S185T	probably damaging	Het
Klk1b1	A	C	7: 43,620,143 (GRCm39)	K202T	probably benign	Het
Liph	T	C	16: 21,786,818 (GRCm39)	Y268C	probably damaging	Het
Mroh2a	C	T	1: 88,158,402 (GRCm39)	R150*	probably null	Het
Mroh2a	A	G	1: 88,186,386 (GRCm39)	S64G	probably benign	Het
Myo9b	G	A	8: 71,783,400 (GRCm39)	D574N	probably damaging	Het
Nfyb	G	A	10: 82,590,836 (GRCm39)	A65V	possibly damaging	Het
Olfm3	T	A	3: 114,916,194 (GRCm39)	N355K	probably benign	Het
Or4k15c	A	T	14: 50,321,689 (GRCm39)	F150I	probably benign	Het
Pcdhb21	A	G	18: 37,648,370 (GRCm39)	T500A	probably benign	Het
Pclo	A	G	5: 14,764,033 (GRCm39)	I4169V	unknown	Het
Pde4d	T	C	13: 109,877,078 (GRCm39)	S144P	possibly damaging	Het
Pgghg	T	C	7: 140,523,191 (GRCm39)	Y157H	probably benign	Het
Pkd1l3	C	G	8: 110,350,281 (GRCm39)	D375E	possibly damaging	Het
Pla2g12a	T	C	3: 129,674,947 (GRCm39)		probably null	Het
Ppp1r14d	T	C	2: 119,060,093 (GRCm39)	D63G	probably damaging	Het
Sema6a	G	A	18: 47,423,112 (GRCm39)		probably null	Het
Sgip1	A	T	4: 102,823,449 (GRCm39)	D690V	probably damaging	Het
Skp1	T	C	11: 52,134,592 (GRCm39)		probably benign	Het
Slc25a12	T	C	2: 71,141,837 (GRCm39)	Y272C	possibly damaging	Het
Slc37a2	A	G	9: 37,146,846 (GRCm39)		probably benign	Het
Snx6	A	T	12: 54,810,441 (GRCm39)	S112T	probably benign	Het
Sox6	A	G	7: 115,085,786 (GRCm39)	V685A	probably damaging	Het
Taf2	A	T	15: 54,926,461 (GRCm39)	V163E	possibly damaging	Het
Tg	A	T	15: 66,711,253 (GRCm39)		probably benign	Het
Tmem30c	A	G	16: 57,090,536 (GRCm39)	Y224H	probably damaging	Het
Tmem45b	T	C	9: 31,339,879 (GRCm39)	N173D	probably benign	Het
Traf5	T	C	1: 191,729,837 (GRCm39)	T405A	probably benign	Het
Trerf1	C	T	17: 47,630,300 (GRCm39)		noncoding transcript	Het
Triobp	A	T	15: 78,844,188 (GRCm39)	K135*	probably null	Het
Ttll9	T	A	2: 152,825,047 (GRCm39)	D75E	probably benign	Het
Vmn1r63	T	C	7: 5,806,609 (GRCm39)	I8V	probably benign	Het
Vmn2r77	A	T	7: 86,460,872 (GRCm39)	I733F	probably damaging	Het
Vmn2r98	T	C	17: 19,300,782 (GRCm39)	S595P	possibly damaging	Het
Zcchc2	C	T	1: 105,958,234 (GRCm39)	Q504*	probably null	Het
Zfp2	T	C	11: 50,791,734 (GRCm39)	D103G	probably benign	Het
Zfp59	A	G	7: 27,553,142 (GRCm39)	K198R	probably benign	Het
Zfp64	C	A	2: 168,777,121 (GRCm39)		probably benign	Het

Other mutations in Nipbl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Nipbl	APN	15	8,396,157 (GRCm39)	missense	probably damaging	0.98
IGL00712:Nipbl	APN	15	8,398,958 (GRCm39)	missense	probably damaging	0.97
IGL00789:Nipbl	APN	15	8,326,353 (GRCm39)	missense	probably damaging	1.00
IGL01025:Nipbl	APN	15	8,379,939 (GRCm39)	missense	possibly damaging	0.46
IGL01087:Nipbl	APN	15	8,379,981 (GRCm39)	missense	possibly damaging	0.67
IGL01474:Nipbl	APN	15	8,340,693 (GRCm39)	missense	possibly damaging	0.63
IGL01537:Nipbl	APN	15	8,380,023 (GRCm39)	missense	probably benign
IGL01723:Nipbl	APN	15	8,364,555 (GRCm39)	missense	possibly damaging	0.71
IGL01749:Nipbl	APN	15	8,391,305 (GRCm39)	missense	probably benign	0.13
IGL02398:Nipbl	APN	15	8,356,574 (GRCm39)	missense	probably damaging	1.00
IGL02437:Nipbl	APN	15	8,388,558 (GRCm39)	missense	probably damaging	1.00
IGL02450:Nipbl	APN	15	8,373,058 (GRCm39)	missense	probably damaging	0.99
IGL02477:Nipbl	APN	15	8,353,131 (GRCm39)	splice site	probably null
IGL02547:Nipbl	APN	15	8,381,082 (GRCm39)	missense	probably benign
IGL02678:Nipbl	APN	15	8,380,594 (GRCm39)	missense	possibly damaging	0.92
IGL02679:Nipbl	APN	15	8,325,037 (GRCm39)	missense	probably benign	0.34
IGL03003:Nipbl	APN	15	8,379,798 (GRCm39)	missense	probably damaging	1.00
IGL03117:Nipbl	APN	15	8,361,936 (GRCm39)	missense	probably damaging	1.00
IGL03162:Nipbl	APN	15	8,368,463 (GRCm39)	missense	probably benign	0.37
IGL03224:Nipbl	APN	15	8,322,569 (GRCm39)	missense	probably damaging	0.98
IGL03339:Nipbl	APN	15	8,380,360 (GRCm39)	missense	probably benign	0.12
R0346_Nipbl_297	UTSW	15	8,390,440 (GRCm39)	missense	probably damaging	0.99
R0347_Nipbl_476	UTSW	15	8,380,216 (GRCm39)	missense	probably benign
R3620_nipbl_616	UTSW	15	8,362,508 (GRCm39)	missense	probably damaging	0.99
R6388_Nipbl_651	UTSW	15	8,330,268 (GRCm39)	missense	probably damaging	0.99
R8441_Nipbl_224	UTSW	15	8,322,599 (GRCm39)	missense	probably benign	0.00
R0271:Nipbl	UTSW	15	8,391,221 (GRCm39)	missense	possibly damaging	0.76
R0346:Nipbl	UTSW	15	8,390,440 (GRCm39)	missense	probably damaging	0.99
R0347:Nipbl	UTSW	15	8,380,216 (GRCm39)	missense	probably benign
R0422:Nipbl	UTSW	15	8,381,112 (GRCm39)	missense	probably benign
R0486:Nipbl	UTSW	15	8,368,354 (GRCm39)	splice site	probably benign
R0652:Nipbl	UTSW	15	8,332,964 (GRCm39)	missense	probably benign	0.23
R0667:Nipbl	UTSW	15	8,390,488 (GRCm39)	missense	possibly damaging	0.86
R0726:Nipbl	UTSW	15	8,381,039 (GRCm39)	missense	probably benign
R0881:Nipbl	UTSW	15	8,337,096 (GRCm39)	missense	probably damaging	0.98
R0904:Nipbl	UTSW	15	8,391,202 (GRCm39)	missense	probably benign
R0969:Nipbl	UTSW	15	8,321,712 (GRCm39)	missense	probably damaging	1.00
R1401:Nipbl	UTSW	15	8,401,657 (GRCm39)	missense	probably damaging	0.97
R1479:Nipbl	UTSW	15	8,379,773 (GRCm39)	missense	probably benign	0.00
R1495:Nipbl	UTSW	15	8,380,764 (GRCm39)	missense	probably benign	0.00
R1609:Nipbl	UTSW	15	8,396,148 (GRCm39)	missense	probably damaging	1.00
R1679:Nipbl	UTSW	15	8,332,396 (GRCm39)	missense	probably benign	0.31
R1756:Nipbl	UTSW	15	8,368,035 (GRCm39)	missense	possibly damaging	0.91
R1778:Nipbl	UTSW	15	8,348,972 (GRCm39)	missense	probably damaging	1.00
R1835:Nipbl	UTSW	15	8,373,001 (GRCm39)	missense	possibly damaging	0.80
R1883:Nipbl	UTSW	15	8,356,616 (GRCm39)	missense	probably damaging	1.00
R1914:Nipbl	UTSW	15	8,373,114 (GRCm39)	missense	possibly damaging	0.93
R1915:Nipbl	UTSW	15	8,373,114 (GRCm39)	missense	possibly damaging	0.93
R2030:Nipbl	UTSW	15	8,379,771 (GRCm39)	missense	probably damaging	1.00
R2046:Nipbl	UTSW	15	8,353,951 (GRCm39)	missense	probably benign	0.08
R2076:Nipbl	UTSW	15	8,340,691 (GRCm39)	missense	probably benign	0.11
R2163:Nipbl	UTSW	15	8,366,403 (GRCm39)	missense	probably damaging	0.99
R2170:Nipbl	UTSW	15	8,322,702 (GRCm39)	missense	probably damaging	1.00
R2425:Nipbl	UTSW	15	8,380,966 (GRCm39)	missense	probably benign	0.06
R2475:Nipbl	UTSW	15	8,364,490 (GRCm39)	missense	probably benign	0.05
R2484:Nipbl	UTSW	15	8,353,182 (GRCm39)	missense	probably damaging	0.99
R2970:Nipbl	UTSW	15	8,340,723 (GRCm39)	missense	probably damaging	1.00
R3116:Nipbl	UTSW	15	8,373,076 (GRCm39)	missense	probably benign	0.00
R3620:Nipbl	UTSW	15	8,362,508 (GRCm39)	missense	probably damaging	0.99
R3725:Nipbl	UTSW	15	8,325,145 (GRCm39)	missense	probably damaging	0.97
R3745:Nipbl	UTSW	15	8,388,358 (GRCm39)	missense	probably benign
R3902:Nipbl	UTSW	15	8,379,730 (GRCm39)	missense	possibly damaging	0.94
R3960:Nipbl	UTSW	15	8,380,018 (GRCm39)	missense	probably benign
R4164:Nipbl	UTSW	15	8,368,418 (GRCm39)	missense	probably benign	0.24
R4246:Nipbl	UTSW	15	8,361,916 (GRCm39)	missense	probably damaging	1.00
R4381:Nipbl	UTSW	15	8,388,690 (GRCm39)	missense	probably benign	0.00
R4394:Nipbl	UTSW	15	8,391,345 (GRCm39)	missense	probably benign	0.00
R4439:Nipbl	UTSW	15	8,368,208 (GRCm39)	missense	probably damaging	0.98
R4440:Nipbl	UTSW	15	8,396,142 (GRCm39)	missense	probably damaging	0.98
R4441:Nipbl	UTSW	15	8,396,142 (GRCm39)	missense	probably damaging	0.98
R4672:Nipbl	UTSW	15	8,332,468 (GRCm39)	missense	probably damaging	1.00
R4749:Nipbl	UTSW	15	8,395,313 (GRCm39)	missense	possibly damaging	0.95
R5300:Nipbl	UTSW	15	8,380,981 (GRCm39)	missense	probably benign
R5428:Nipbl	UTSW	15	8,359,780 (GRCm39)	missense	probably benign	0.00
R5641:Nipbl	UTSW	15	8,396,196 (GRCm39)	missense	possibly damaging	0.93
R5643:Nipbl	UTSW	15	8,388,391 (GRCm39)	missense	probably benign
R5644:Nipbl	UTSW	15	8,388,391 (GRCm39)	missense	probably benign
R5681:Nipbl	UTSW	15	8,330,866 (GRCm39)	missense	probably benign	0.22
R5741:Nipbl	UTSW	15	8,354,133 (GRCm39)	missense	possibly damaging	0.47
R5899:Nipbl	UTSW	15	8,364,328 (GRCm39)	splice site	probably null
R5970:Nipbl	UTSW	15	8,326,302 (GRCm39)	missense	probably benign	0.27
R6041:Nipbl	UTSW	15	8,353,748 (GRCm39)	missense	probably damaging	1.00
R6059:Nipbl	UTSW	15	8,325,052 (GRCm39)	missense	probably damaging	1.00
R6213:Nipbl	UTSW	15	8,364,390 (GRCm39)	missense	probably damaging	1.00
R6216:Nipbl	UTSW	15	8,347,867 (GRCm39)	missense	probably damaging	0.99
R6236:Nipbl	UTSW	15	8,354,064 (GRCm39)	missense	possibly damaging	0.88
R6267:Nipbl	UTSW	15	8,330,379 (GRCm39)	missense	possibly damaging	0.46
R6296:Nipbl	UTSW	15	8,330,379 (GRCm39)	missense	possibly damaging	0.46
R6388:Nipbl	UTSW	15	8,330,268 (GRCm39)	missense	probably damaging	0.99
R6427:Nipbl	UTSW	15	8,381,049 (GRCm39)	missense	probably benign
R6707:Nipbl	UTSW	15	8,354,043 (GRCm39)	missense	probably benign	0.01
R6731:Nipbl	UTSW	15	8,352,074 (GRCm39)	missense	probably damaging	1.00
R6921:Nipbl	UTSW	15	8,332,969 (GRCm39)	missense	probably benign	0.28
R7239:Nipbl	UTSW	15	8,321,619 (GRCm39)	critical splice donor site	probably null
R7346:Nipbl	UTSW	15	8,373,090 (GRCm39)	missense	possibly damaging	0.94
R7485:Nipbl	UTSW	15	8,359,779 (GRCm39)	missense	probably benign	0.01
R7486:Nipbl	UTSW	15	8,325,120 (GRCm39)	missense	probably benign	0.25
R7598:Nipbl	UTSW	15	8,372,977 (GRCm39)	missense	probably benign	0.24
R7609:Nipbl	UTSW	15	8,335,356 (GRCm39)	missense	probably benign	0.27
R7674:Nipbl	UTSW	15	8,322,585 (GRCm39)	missense	probably benign	0.15
R7706:Nipbl	UTSW	15	8,381,010 (GRCm39)	missense	probably benign	0.01
R7760:Nipbl	UTSW	15	8,388,186 (GRCm39)	missense	probably damaging	1.00
R7766:Nipbl	UTSW	15	8,326,333 (GRCm39)	missense	probably benign	0.45
R7825:Nipbl	UTSW	15	8,320,971 (GRCm39)	missense	probably damaging	1.00
R7862:Nipbl	UTSW	15	8,355,236 (GRCm39)	missense	probably benign	0.06
R7958:Nipbl	UTSW	15	8,340,742 (GRCm39)	missense	possibly damaging	0.91
R8077:Nipbl	UTSW	15	8,340,734 (GRCm39)	missense	possibly damaging	0.49
R8119:Nipbl	UTSW	15	8,388,696 (GRCm39)	missense	probably benign	0.22
R8355:Nipbl	UTSW	15	8,364,528 (GRCm39)	missense	probably damaging	0.98
R8441:Nipbl	UTSW	15	8,322,599 (GRCm39)	missense	probably benign	0.00
R8455:Nipbl	UTSW	15	8,364,528 (GRCm39)	missense	probably damaging	0.98
R8717:Nipbl	UTSW	15	8,368,225 (GRCm39)	missense	probably benign
R8739:Nipbl	UTSW	15	8,332,904 (GRCm39)	missense	probably benign	0.08
R8854:Nipbl	UTSW	15	8,330,210 (GRCm39)	missense	probably damaging	1.00
R8887:Nipbl	UTSW	15	8,391,271 (GRCm39)	missense	probably damaging	1.00
R8942:Nipbl	UTSW	15	8,381,104 (GRCm39)	missense	probably benign
R8991:Nipbl	UTSW	15	8,320,997 (GRCm39)	missense	probably damaging	1.00
R9008:Nipbl	UTSW	15	8,356,608 (GRCm39)	missense	probably damaging	1.00
R9070:Nipbl	UTSW	15	8,368,215 (GRCm39)	missense	possibly damaging	0.82
R9116:Nipbl	UTSW	15	8,380,340 (GRCm39)	missense	probably benign	0.00
R9622:Nipbl	UTSW	15	8,366,373 (GRCm39)	missense	probably benign	0.27
R9778:Nipbl	UTSW	15	8,321,032 (GRCm39)	missense	probably benign	0.10
RF020:Nipbl	UTSW	15	8,388,418 (GRCm39)	missense	probably damaging	0.98
X0022:Nipbl	UTSW	15	8,381,199 (GRCm39)	missense	probably benign	0.05
X0027:Nipbl	UTSW	15	8,353,021 (GRCm39)	missense	probably damaging	1.00
Z1088:Nipbl	UTSW	15	8,337,366 (GRCm39)	missense	probably damaging	1.00
Z1176:Nipbl	UTSW	15	8,368,183 (GRCm39)	missense	possibly damaging	0.88
Z1177:Nipbl	UTSW	15	8,368,164 (GRCm39)	critical splice donor site	probably null
Z1177:Nipbl	UTSW	15	8,366,436 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCAGGAGGGTAAGGGACCCAT -3'
(R):5'- TCGCTGAGAGCAAAGGGGCA -3'

Sequencing Primer
(F):5'- GTGGGAAAGTTAGCCCAACA -3'
(R):5'- TGGGTGAGATCTGTAGGATTTAAAAC -3'

Posted On

2014-08-20