Incidental Mutation 'R0632:Dnah17'
ID 218789
Institutional Source Beutler Lab
Gene Symbol Dnah17
Ensembl Gene ENSMUSG00000033987
Gene Name dynein, axonemal, heavy chain 17
Synonyms Dnahcl1, LOC382552, 2810003K23Rik, Dnahc17
MMRRC Submission 038821-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0632 (G1)
Quality Score 69
Status Validated
Chromosome 11
Chromosomal Location 117912549-118021460 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to G at 117958508 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084803] [ENSMUST00000106308] [ENSMUST00000132685]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000084803
SMART Domains Protein: ENSMUSP00000081864
Gene: ENSMUSG00000033987

DomainStartEndE-ValueType
Pfam:DHC_N1 183 766 8.5e-142 PFAM
low complexity region 1015 1028 N/A INTRINSIC
Pfam:DHC_N2 1260 1673 5.8e-135 PFAM
Pfam:AAA_6 1793 2023 6e-161 PFAM
low complexity region 2092 2104 N/A INTRINSIC
Pfam:AAA_5 2107 2243 7.8e-13 PFAM
Pfam:AAA_7 2400 2671 1.1e-171 PFAM
Pfam:AAA_8 2748 3015 4.9e-166 PFAM
Pfam:MT 3027 3370 3.4e-214 PFAM
Pfam:AAA_9 3388 3615 2.4e-144 PFAM
Pfam:Dynein_heavy 3742 4452 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106308
SMART Domains Protein: ENSMUSP00000101915
Gene: ENSMUSG00000033987

DomainStartEndE-ValueType
Pfam:DHC_N1 184 764 1.7e-152 PFAM
low complexity region 1015 1028 N/A INTRINSIC
Pfam:DHC_N2 1262 1671 4.1e-132 PFAM
Pfam:AAA_6 1793 2023 7e-149 PFAM
low complexity region 2092 2104 N/A INTRINSIC
Pfam:AAA_5 2107 2243 2.5e-11 PFAM
Pfam:AAA_7 2400 2671 4.4e-169 PFAM
Pfam:AAA_8 2748 3015 7.1e-163 PFAM
Pfam:MT 3027 3370 1.1e-210 PFAM
Pfam:AAA_9 3392 3614 1e-84 PFAM
Pfam:Dynein_heavy 3748 4479 3.5e-230 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132685
SMART Domains Protein: ENSMUSP00000120542
Gene: ENSMUSG00000033987

DomainStartEndE-ValueType
Pfam:DHC_N2 279 688 3.1e-132 PFAM
Pfam:AAA_6 811 1041 5.3e-149 PFAM
low complexity region 1110 1122 N/A INTRINSIC
Blast:AAA 1123 1354 1e-104 BLAST
Pfam:AAA_7 1452 1671 8.9e-134 PFAM
Pfam:AAA_8 1763 2030 5.4e-163 PFAM
Pfam:MT 2042 2168 6.8e-52 PFAM
Pfam:MT 2163 2412 8.2e-149 PFAM
Pfam:AAA_9 2434 2656 7.9e-85 PFAM
Pfam:Dynein_heavy 2790 3457 2.6e-209 PFAM
Pfam:Dynein_heavy 3460 3569 4.6e-17 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. DNAH17 is a heavy chain associated with axonemal dynein (Milisav and Affara, 1998 [PubMed 9545504]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1a T A 9: 119,176,884 (GRCm39) probably benign Het
Adgrg7 T A 16: 56,562,952 (GRCm39) T462S possibly damaging Het
Akap6 A T 12: 52,983,931 (GRCm39) N825I probably damaging Het
Ankib1 T A 5: 3,822,529 (GRCm39) N59I probably benign Het
Anks6 T C 4: 47,033,167 (GRCm39) S633G possibly damaging Het
Ap4e1 C A 2: 126,891,200 (GRCm39) Y522* probably null Het
Art5 G A 7: 101,747,164 (GRCm39) T205I probably damaging Het
Ascc2 T A 11: 4,599,855 (GRCm39) L176H probably damaging Het
Atp13a5 T C 16: 29,117,026 (GRCm39) D529G probably benign Het
C2cd4a T C 9: 67,738,845 (GRCm39) E66G probably benign Het
C8a T C 4: 104,713,689 (GRCm39) D147G probably damaging Het
Ccdc14 T C 16: 34,542,019 (GRCm39) V532A possibly damaging Het
Ccdc88a T A 11: 29,432,749 (GRCm39) probably benign Het
Cfap54 C T 10: 92,720,958 (GRCm39) E2543K unknown Het
Cldn13 C T 5: 134,943,601 (GRCm39) E195K probably benign Het
Cp A G 3: 20,025,246 (GRCm39) S402G probably null Het
Cpa3 T C 3: 20,279,358 (GRCm39) T194A probably benign Het
Crygf C A 1: 65,967,156 (GRCm39) Y93* probably null Het
Ctsh A G 9: 89,943,635 (GRCm39) R87G possibly damaging Het
Cyp2t4 A G 7: 26,857,671 (GRCm39) D428G possibly damaging Het
Dnah3 A G 7: 119,567,128 (GRCm39) V2366A probably benign Het
Dscaml1 A T 9: 45,643,432 (GRCm39) I1284F probably benign Het
Dsg1c T C 18: 20,405,403 (GRCm39) probably benign Het
Dst G T 1: 34,310,494 (GRCm39) R4098L probably damaging Het
Efhb A G 17: 53,720,487 (GRCm39) probably benign Het
Epha7 A T 4: 28,821,104 (GRCm39) I90F probably damaging Het
Fam171a2 T A 11: 102,328,707 (GRCm39) D684V probably damaging Het
Fan1 A G 7: 64,012,947 (GRCm39) V665A possibly damaging Het
Fbn2 A G 18: 58,170,819 (GRCm39) C2191R probably damaging Het
Fkbp3 G A 12: 65,120,692 (GRCm39) A2V probably benign Het
G6pd2 A G 5: 61,967,514 (GRCm39) N430D probably benign Het
Gm13547 T A 2: 29,651,596 (GRCm39) D7E possibly damaging Het
H4c9 G T 13: 22,225,197 (GRCm39) Y99* probably null Het
Hdac5 A T 11: 102,096,638 (GRCm39) D260E probably damaging Het
Hsf2bp T C 17: 32,232,320 (GRCm39) E142G probably damaging Het
Igf1r C T 7: 67,814,903 (GRCm39) T268I probably damaging Het
Inava T C 1: 136,155,356 (GRCm39) D83G probably benign Het
Kcne3 C T 7: 99,833,646 (GRCm39) R88C probably damaging Het
Klk1b9 G T 7: 43,628,796 (GRCm39) G100V possibly damaging Het
Kmt2d G A 15: 98,751,462 (GRCm39) probably benign Het
Lama1 C T 17: 68,059,363 (GRCm39) probably benign Het
Lcp2 C T 11: 34,032,426 (GRCm39) P335S possibly damaging Het
Lrrk2 T A 15: 91,680,231 (GRCm39) N2047K probably damaging Het
Mcub T C 3: 129,712,375 (GRCm39) M167V probably benign Het
Mia2 T C 12: 59,182,929 (GRCm39) L36P probably damaging Het
Mmp13 G A 9: 7,274,032 (GRCm39) G169R probably damaging Het
Mmp13 A T 9: 7,282,077 (GRCm39) I460F possibly damaging Het
Msh4 A G 3: 153,602,532 (GRCm39) I232T probably damaging Het
Msra T A 14: 64,447,981 (GRCm39) M145L probably benign Het
Myo7a A T 7: 97,761,357 (GRCm39) probably benign Het
Nme8 A T 13: 19,842,206 (GRCm39) N422K probably damaging Het
Nol6 A T 4: 41,121,115 (GRCm39) F353I probably damaging Het
Nphp3 A G 9: 103,895,473 (GRCm39) K384E probably damaging Het
Or51h5 C T 7: 102,577,811 (GRCm39) probably null Het
Or52e15 A G 7: 104,645,910 (GRCm39) I67T probably benign Het
Or52h7 A G 7: 104,213,544 (GRCm39) I39V probably benign Het
Phox2b T G 5: 67,253,557 (GRCm39) probably benign Het
Plec A T 15: 76,057,611 (GRCm39) S4131T probably damaging Het
Pptc7 G A 5: 122,451,654 (GRCm39) probably benign Het
Pramel31 G A 4: 144,090,352 (GRCm39) C464Y probably damaging Het
Prpf40b A G 15: 99,214,170 (GRCm39) E810G probably benign Het
Ptprc C T 1: 138,001,348 (GRCm39) V965I probably benign Het
Pum1 T A 4: 130,455,415 (GRCm39) M180K probably benign Het
Ranbp3 T C 17: 57,009,896 (GRCm39) probably benign Het
Rasgrf2 A G 13: 92,120,393 (GRCm39) S787P probably benign Het
Rnf19b T A 4: 128,967,344 (GRCm39) N294K probably damaging Het
Samd3 A T 10: 26,120,393 (GRCm39) H156L possibly damaging Het
Serpinb6c C T 13: 34,064,014 (GRCm39) R347Q possibly damaging Het
Slc36a3 A G 11: 55,015,906 (GRCm39) I416T probably damaging Het
Slc4a4 T A 5: 89,277,500 (GRCm39) F279Y probably damaging Het
Slc6a2 T A 8: 93,719,429 (GRCm39) probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Tab2 A G 10: 7,795,565 (GRCm39) S232P probably benign Het
Tacc2 A T 7: 130,227,325 (GRCm39) K1356* probably null Het
Tmem87a A G 2: 120,190,023 (GRCm39) S544P probably damaging Het
Trim52 T A 14: 106,344,401 (GRCm39) C20S probably damaging Het
Usp38 A T 8: 81,740,779 (GRCm39) V96E probably benign Het
Vmn2r59 T C 7: 41,708,308 (GRCm39) Y33C probably damaging Het
Vsig10l T G 7: 43,113,561 (GRCm39) V171G probably damaging Het
Zfp957 T A 14: 79,450,360 (GRCm39) I480F probably damaging Het
Other mutations in Dnah17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Dnah17 APN 11 117,979,040 (GRCm39) missense possibly damaging 0.81
IGL00531:Dnah17 APN 11 117,933,999 (GRCm39) missense probably damaging 0.97
IGL00764:Dnah17 APN 11 117,987,311 (GRCm39) missense probably damaging 0.99
IGL00795:Dnah17 APN 11 117,984,460 (GRCm39) missense probably benign 0.35
IGL00823:Dnah17 APN 11 117,937,987 (GRCm39) missense probably benign 0.22
IGL01145:Dnah17 APN 11 117,937,999 (GRCm39) missense possibly damaging 0.63
IGL01433:Dnah17 APN 11 117,940,760 (GRCm39) missense probably damaging 1.00
IGL01454:Dnah17 APN 11 117,949,223 (GRCm39) missense probably damaging 1.00
IGL01545:Dnah17 APN 11 118,010,394 (GRCm39) missense probably damaging 1.00
IGL01548:Dnah17 APN 11 117,989,438 (GRCm39) missense probably benign 0.21
IGL01557:Dnah17 APN 11 117,964,512 (GRCm39) missense probably damaging 0.98
IGL01632:Dnah17 APN 11 117,924,707 (GRCm39) missense probably damaging 1.00
IGL01636:Dnah17 APN 11 117,931,882 (GRCm39) missense probably benign 0.03
IGL01672:Dnah17 APN 11 117,932,986 (GRCm39) missense probably damaging 0.97
IGL01822:Dnah17 APN 11 117,972,819 (GRCm39) missense probably damaging 1.00
IGL01869:Dnah17 APN 11 117,943,502 (GRCm39) missense probably benign 0.09
IGL01916:Dnah17 APN 11 118,016,114 (GRCm39) missense probably benign 0.00
IGL02131:Dnah17 APN 11 117,963,734 (GRCm39) missense probably damaging 1.00
IGL02154:Dnah17 APN 11 118,015,087 (GRCm39) missense probably benign 0.01
IGL02220:Dnah17 APN 11 117,963,793 (GRCm39) nonsense probably null
IGL02454:Dnah17 APN 11 117,971,593 (GRCm39) missense probably damaging 0.98
IGL02458:Dnah17 APN 11 117,927,176 (GRCm39) missense probably damaging 1.00
IGL02588:Dnah17 APN 11 117,916,479 (GRCm39) missense possibly damaging 0.95
IGL02865:Dnah17 APN 11 117,964,374 (GRCm39) missense probably damaging 1.00
IGL02881:Dnah17 APN 11 117,932,944 (GRCm39) missense probably damaging 1.00
IGL02952:Dnah17 APN 11 117,979,094 (GRCm39) missense probably benign 0.03
IGL03382:Dnah17 APN 11 117,972,769 (GRCm39) missense probably damaging 1.00
IGL03389:Dnah17 APN 11 117,985,805 (GRCm39) missense probably damaging 1.00
ergos UTSW 11 117,931,984 (GRCm39) splice site probably benign
watt UTSW 11 117,971,592 (GRCm39) missense probably damaging 0.96
PIT4280001:Dnah17 UTSW 11 117,989,408 (GRCm39) missense possibly damaging 0.85
R0004:Dnah17 UTSW 11 117,950,918 (GRCm39) missense possibly damaging 0.90
R0112:Dnah17 UTSW 11 117,965,260 (GRCm39) missense possibly damaging 0.82
R0116:Dnah17 UTSW 11 117,949,132 (GRCm39) missense probably benign 0.01
R0157:Dnah17 UTSW 11 118,017,997 (GRCm39) missense probably benign
R0320:Dnah17 UTSW 11 117,943,500 (GRCm39) missense possibly damaging 0.56
R0362:Dnah17 UTSW 11 117,989,365 (GRCm39) missense probably benign 0.10
R0382:Dnah17 UTSW 11 118,019,822 (GRCm39) missense probably damaging 1.00
R0383:Dnah17 UTSW 11 117,958,373 (GRCm39) missense probably benign
R0400:Dnah17 UTSW 11 117,972,904 (GRCm39) missense probably damaging 1.00
R0420:Dnah17 UTSW 11 117,930,765 (GRCm39) missense probably damaging 1.00
R0483:Dnah17 UTSW 11 117,937,950 (GRCm39) missense probably benign
R0533:Dnah17 UTSW 11 118,001,363 (GRCm39) missense possibly damaging 0.50
R0562:Dnah17 UTSW 11 117,963,726 (GRCm39) missense probably damaging 1.00
R0564:Dnah17 UTSW 11 117,973,807 (GRCm39) missense probably damaging 1.00
R0604:Dnah17 UTSW 11 118,012,297 (GRCm39) missense probably benign 0.00
R0608:Dnah17 UTSW 11 117,981,575 (GRCm39) nonsense probably null
R0614:Dnah17 UTSW 11 117,961,394 (GRCm39) splice site probably benign
R0831:Dnah17 UTSW 11 117,951,097 (GRCm39) missense probably damaging 0.99
R0838:Dnah17 UTSW 11 117,950,930 (GRCm39) missense probably damaging 1.00
R0879:Dnah17 UTSW 11 117,947,661 (GRCm39) splice site probably benign
R1061:Dnah17 UTSW 11 117,943,514 (GRCm39) missense possibly damaging 0.51
R1190:Dnah17 UTSW 11 117,933,001 (GRCm39) missense probably damaging 1.00
R1293:Dnah17 UTSW 11 118,017,963 (GRCm39) critical splice donor site probably null
R1297:Dnah17 UTSW 11 118,012,192 (GRCm39) splice site probably benign
R1332:Dnah17 UTSW 11 117,934,041 (GRCm39) missense possibly damaging 0.70
R1336:Dnah17 UTSW 11 117,934,041 (GRCm39) missense possibly damaging 0.70
R1364:Dnah17 UTSW 11 118,016,432 (GRCm39) splice site probably benign
R1418:Dnah17 UTSW 11 117,964,849 (GRCm39) missense probably damaging 0.98
R1432:Dnah17 UTSW 11 117,914,153 (GRCm39) missense probably damaging 1.00
R1497:Dnah17 UTSW 11 118,005,059 (GRCm39) missense probably damaging 1.00
R1500:Dnah17 UTSW 11 117,991,879 (GRCm39) missense probably benign
R1506:Dnah17 UTSW 11 118,016,213 (GRCm39) missense possibly damaging 0.53
R1512:Dnah17 UTSW 11 117,985,841 (GRCm39) missense probably benign
R1567:Dnah17 UTSW 11 118,016,811 (GRCm39) missense probably damaging 1.00
R1597:Dnah17 UTSW 11 117,994,324 (GRCm39) splice site probably benign
R1665:Dnah17 UTSW 11 118,012,321 (GRCm39) splice site probably benign
R1703:Dnah17 UTSW 11 117,917,575 (GRCm39) missense probably damaging 1.00
R1716:Dnah17 UTSW 11 117,923,424 (GRCm39) missense probably benign 0.00
R1727:Dnah17 UTSW 11 117,987,362 (GRCm39) nonsense probably null
R1727:Dnah17 UTSW 11 117,961,315 (GRCm39) missense probably damaging 0.98
R1728:Dnah17 UTSW 11 117,960,345 (GRCm39) missense possibly damaging 0.76
R1784:Dnah17 UTSW 11 117,960,345 (GRCm39) missense possibly damaging 0.76
R1852:Dnah17 UTSW 11 118,012,742 (GRCm39) missense probably damaging 0.97
R1869:Dnah17 UTSW 11 117,938,015 (GRCm39) nonsense probably null
R1886:Dnah17 UTSW 11 117,998,987 (GRCm39) missense possibly damaging 0.62
R1893:Dnah17 UTSW 11 117,957,794 (GRCm39) missense probably benign 0.00
R1954:Dnah17 UTSW 11 117,915,557 (GRCm39) missense probably damaging 1.00
R1969:Dnah17 UTSW 11 117,995,361 (GRCm39) missense probably benign 0.00
R1971:Dnah17 UTSW 11 117,995,361 (GRCm39) missense probably benign 0.00
R1975:Dnah17 UTSW 11 117,987,362 (GRCm39) nonsense probably null
R1977:Dnah17 UTSW 11 118,003,417 (GRCm39) missense possibly damaging 0.52
R2055:Dnah17 UTSW 11 117,958,357 (GRCm39) missense probably benign 0.00
R2115:Dnah17 UTSW 11 118,010,628 (GRCm39) missense probably benign 0.00
R2132:Dnah17 UTSW 11 117,924,573 (GRCm39) missense probably damaging 0.98
R2200:Dnah17 UTSW 11 117,993,235 (GRCm39) splice site probably benign
R2277:Dnah17 UTSW 11 117,987,387 (GRCm39) missense possibly damaging 0.81
R2279:Dnah17 UTSW 11 117,987,387 (GRCm39) missense possibly damaging 0.81
R2400:Dnah17 UTSW 11 118,017,210 (GRCm39) critical splice acceptor site probably null
R2402:Dnah17 UTSW 11 118,016,800 (GRCm39) missense probably benign 0.10
R2497:Dnah17 UTSW 11 117,977,850 (GRCm39) splice site probably null
R2923:Dnah17 UTSW 11 117,984,373 (GRCm39) missense probably damaging 1.00
R3121:Dnah17 UTSW 11 117,931,912 (GRCm39) missense probably damaging 1.00
R3236:Dnah17 UTSW 11 117,985,680 (GRCm39) missense probably benign 0.08
R3237:Dnah17 UTSW 11 117,985,680 (GRCm39) missense probably benign 0.08
R3498:Dnah17 UTSW 11 117,971,675 (GRCm39) splice site probably benign
R3499:Dnah17 UTSW 11 117,971,675 (GRCm39) splice site probably benign
R3746:Dnah17 UTSW 11 117,973,742 (GRCm39) missense probably benign 0.00
R3749:Dnah17 UTSW 11 117,973,742 (GRCm39) missense probably benign 0.00
R3762:Dnah17 UTSW 11 117,995,352 (GRCm39) missense probably benign 0.00
R3826:Dnah17 UTSW 11 117,931,984 (GRCm39) splice site probably benign
R3828:Dnah17 UTSW 11 117,931,984 (GRCm39) splice site probably benign
R3829:Dnah17 UTSW 11 117,931,984 (GRCm39) splice site probably benign
R3877:Dnah17 UTSW 11 117,915,533 (GRCm39) missense probably damaging 1.00
R3899:Dnah17 UTSW 11 117,985,634 (GRCm39) missense possibly damaging 0.78
R3900:Dnah17 UTSW 11 117,985,634 (GRCm39) missense possibly damaging 0.78
R3911:Dnah17 UTSW 11 117,971,675 (GRCm39) splice site probably benign
R3913:Dnah17 UTSW 11 117,971,675 (GRCm39) splice site probably benign
R3930:Dnah17 UTSW 11 117,971,675 (GRCm39) splice site probably benign
R3931:Dnah17 UTSW 11 117,971,675 (GRCm39) splice site probably benign
R3969:Dnah17 UTSW 11 117,931,984 (GRCm39) splice site probably benign
R3970:Dnah17 UTSW 11 117,931,984 (GRCm39) splice site probably benign
R4056:Dnah17 UTSW 11 117,961,364 (GRCm39) missense probably benign 0.05
R4113:Dnah17 UTSW 11 118,003,420 (GRCm39) missense possibly damaging 0.50
R4295:Dnah17 UTSW 11 118,009,598 (GRCm39) missense probably damaging 1.00
R4324:Dnah17 UTSW 11 117,985,039 (GRCm39) missense probably benign 0.01
R4412:Dnah17 UTSW 11 117,964,509 (GRCm39) missense probably damaging 1.00
R4413:Dnah17 UTSW 11 117,915,994 (GRCm39) missense probably benign 0.00
R4422:Dnah17 UTSW 11 117,972,799 (GRCm39) missense possibly damaging 0.91
R4552:Dnah17 UTSW 11 117,943,769 (GRCm39) missense possibly damaging 0.79
R4669:Dnah17 UTSW 11 117,965,119 (GRCm39) missense probably benign 0.02
R4677:Dnah17 UTSW 11 118,010,640 (GRCm39) missense probably damaging 1.00
R4716:Dnah17 UTSW 11 117,964,474 (GRCm39) missense probably benign 0.02
R4832:Dnah17 UTSW 11 117,917,606 (GRCm39) missense probably damaging 1.00
R4868:Dnah17 UTSW 11 117,999,038 (GRCm39) missense probably benign 0.03
R4897:Dnah17 UTSW 11 117,969,419 (GRCm39) missense probably damaging 1.00
R4928:Dnah17 UTSW 11 117,918,259 (GRCm39) missense probably damaging 1.00
R4937:Dnah17 UTSW 11 117,932,980 (GRCm39) missense probably damaging 1.00
R4957:Dnah17 UTSW 11 117,965,124 (GRCm39) missense probably benign 0.44
R5008:Dnah17 UTSW 11 118,001,403 (GRCm39) missense probably benign 0.01
R5016:Dnah17 UTSW 11 117,971,592 (GRCm39) missense probably damaging 0.96
R5027:Dnah17 UTSW 11 117,993,365 (GRCm39) missense probably benign 0.01
R5133:Dnah17 UTSW 11 118,007,939 (GRCm39) missense probably benign 0.00
R5140:Dnah17 UTSW 11 117,977,771 (GRCm39) missense probably damaging 1.00
R5146:Dnah17 UTSW 11 118,005,005 (GRCm39) missense probably damaging 0.99
R5151:Dnah17 UTSW 11 117,918,293 (GRCm39) missense probably damaging 1.00
R5153:Dnah17 UTSW 11 117,973,800 (GRCm39) nonsense probably null
R5192:Dnah17 UTSW 11 117,925,185 (GRCm39) missense possibly damaging 0.96
R5315:Dnah17 UTSW 11 118,018,109 (GRCm39) missense possibly damaging 0.79
R5317:Dnah17 UTSW 11 118,018,109 (GRCm39) missense possibly damaging 0.79
R5335:Dnah17 UTSW 11 118,003,340 (GRCm39) missense probably damaging 1.00
R5379:Dnah17 UTSW 11 118,008,029 (GRCm39) intron probably benign
R5396:Dnah17 UTSW 11 118,018,108 (GRCm39) missense probably benign
R5418:Dnah17 UTSW 11 117,985,810 (GRCm39) missense probably benign 0.04
R5534:Dnah17 UTSW 11 117,943,596 (GRCm39) missense possibly damaging 0.83
R5539:Dnah17 UTSW 11 117,964,486 (GRCm39) missense probably benign 0.03
R5594:Dnah17 UTSW 11 117,934,055 (GRCm39) splice site probably null
R5634:Dnah17 UTSW 11 117,943,752 (GRCm39) splice site probably null
R5696:Dnah17 UTSW 11 117,991,882 (GRCm39) missense probably benign 0.44
R5802:Dnah17 UTSW 11 117,927,272 (GRCm39) missense possibly damaging 0.79
R5826:Dnah17 UTSW 11 117,925,193 (GRCm39) missense probably damaging 1.00
R5873:Dnah17 UTSW 11 117,947,723 (GRCm39) missense probably benign 0.01
R5898:Dnah17 UTSW 11 118,005,039 (GRCm39) missense probably benign 0.00
R5934:Dnah17 UTSW 11 117,931,928 (GRCm39) missense probably benign
R6030:Dnah17 UTSW 11 117,916,375 (GRCm39) missense probably benign 0.32
R6030:Dnah17 UTSW 11 117,916,375 (GRCm39) missense probably benign 0.32
R6038:Dnah17 UTSW 11 117,946,715 (GRCm39) missense probably benign 0.00
R6038:Dnah17 UTSW 11 117,946,715 (GRCm39) missense probably benign 0.00
R6113:Dnah17 UTSW 11 118,017,101 (GRCm39) missense probably damaging 1.00
R6117:Dnah17 UTSW 11 118,010,397 (GRCm39) missense probably benign 0.00
R6137:Dnah17 UTSW 11 117,916,480 (GRCm39) missense probably damaging 1.00
R6173:Dnah17 UTSW 11 117,930,772 (GRCm39) missense probably damaging 1.00
R6258:Dnah17 UTSW 11 118,017,149 (GRCm39) nonsense probably null
R6258:Dnah17 UTSW 11 118,017,148 (GRCm39) missense probably damaging 1.00
R6258:Dnah17 UTSW 11 118,017,150 (GRCm39) missense probably damaging 1.00
R6260:Dnah17 UTSW 11 118,017,150 (GRCm39) missense probably damaging 1.00
R6260:Dnah17 UTSW 11 118,017,148 (GRCm39) missense probably damaging 1.00
R6260:Dnah17 UTSW 11 118,017,149 (GRCm39) nonsense probably null
R6278:Dnah17 UTSW 11 118,017,116 (GRCm39) missense probably damaging 0.99
R6298:Dnah17 UTSW 11 117,998,987 (GRCm39) missense probably benign 0.00
R6300:Dnah17 UTSW 11 117,925,136 (GRCm39) missense probably damaging 1.00
R6302:Dnah17 UTSW 11 118,019,981 (GRCm39) missense probably benign 0.09
R6363:Dnah17 UTSW 11 118,001,331 (GRCm39) missense probably benign
R6381:Dnah17 UTSW 11 118,020,011 (GRCm39) missense probably benign 0.08
R6418:Dnah17 UTSW 11 118,020,023 (GRCm39) missense probably damaging 0.99
R6660:Dnah17 UTSW 11 117,991,014 (GRCm39) missense probably benign
R6803:Dnah17 UTSW 11 118,016,198 (GRCm39) missense probably benign 0.00
R6820:Dnah17 UTSW 11 117,959,826 (GRCm39) missense probably damaging 0.99
R6885:Dnah17 UTSW 11 117,981,598 (GRCm39) missense possibly damaging 0.47
R6921:Dnah17 UTSW 11 117,932,310 (GRCm39) missense probably damaging 0.98
R6932:Dnah17 UTSW 11 117,950,905 (GRCm39) missense possibly damaging 0.95
R6954:Dnah17 UTSW 11 117,957,258 (GRCm39) missense probably damaging 1.00
R7000:Dnah17 UTSW 11 117,916,528 (GRCm39) critical splice acceptor site probably null
R7007:Dnah17 UTSW 11 118,009,697 (GRCm39) missense possibly damaging 0.92
R7048:Dnah17 UTSW 11 117,936,944 (GRCm39) missense possibly damaging 0.80
R7056:Dnah17 UTSW 11 118,016,212 (GRCm39) missense probably benign
R7131:Dnah17 UTSW 11 117,970,484 (GRCm39) missense probably benign 0.14
R7143:Dnah17 UTSW 11 117,976,956 (GRCm39) missense probably damaging 1.00
R7146:Dnah17 UTSW 11 117,972,936 (GRCm39) missense probably damaging 0.98
R7147:Dnah17 UTSW 11 117,985,755 (GRCm39) missense probably benign 0.31
R7172:Dnah17 UTSW 11 117,931,957 (GRCm39) nonsense probably null
R7183:Dnah17 UTSW 11 118,020,014 (GRCm39) missense probably benign
R7297:Dnah17 UTSW 11 117,994,182 (GRCm39) missense probably damaging 0.98
R7297:Dnah17 UTSW 11 117,946,556 (GRCm39) critical splice donor site probably null
R7367:Dnah17 UTSW 11 118,006,022 (GRCm39) missense probably benign
R7398:Dnah17 UTSW 11 117,971,550 (GRCm39) missense probably damaging 0.96
R7426:Dnah17 UTSW 11 117,981,543 (GRCm39) missense probably null 0.79
R7524:Dnah17 UTSW 11 118,012,307 (GRCm39) missense probably benign 0.03
R7529:Dnah17 UTSW 11 117,940,692 (GRCm39) critical splice donor site probably null
R7615:Dnah17 UTSW 11 118,001,373 (GRCm39) nonsense probably null
R7681:Dnah17 UTSW 11 117,916,012 (GRCm39) missense probably damaging 1.00
R7702:Dnah17 UTSW 11 118,012,304 (GRCm39) missense possibly damaging 0.64
R7702:Dnah17 UTSW 11 117,916,466 (GRCm39) missense probably benign 0.00
R7713:Dnah17 UTSW 11 117,915,997 (GRCm39) missense probably benign 0.02
R7809:Dnah17 UTSW 11 117,995,462 (GRCm39) missense probably benign 0.09
R7842:Dnah17 UTSW 11 117,970,508 (GRCm39) critical splice acceptor site probably null
R7935:Dnah17 UTSW 11 118,018,048 (GRCm39) missense probably benign 0.20
R7951:Dnah17 UTSW 11 118,009,592 (GRCm39) missense possibly damaging 0.64
R8070:Dnah17 UTSW 11 117,915,497 (GRCm39) missense probably damaging 0.97
R8098:Dnah17 UTSW 11 117,941,193 (GRCm39) missense probably damaging 1.00
R8101:Dnah17 UTSW 11 118,016,744 (GRCm39) missense probably benign
R8177:Dnah17 UTSW 11 118,019,753 (GRCm39) missense possibly damaging 0.60
R8343:Dnah17 UTSW 11 118,005,021 (GRCm39) missense probably benign
R8350:Dnah17 UTSW 11 117,977,873 (GRCm39) missense probably damaging 0.98
R8393:Dnah17 UTSW 11 117,947,855 (GRCm39) missense probably damaging 1.00
R8401:Dnah17 UTSW 11 117,915,485 (GRCm39) missense probably damaging 0.96
R8418:Dnah17 UTSW 11 117,994,284 (GRCm39) missense probably benign 0.01
R8450:Dnah17 UTSW 11 117,977,873 (GRCm39) missense probably damaging 0.98
R8546:Dnah17 UTSW 11 118,015,101 (GRCm39) missense probably benign 0.00
R8697:Dnah17 UTSW 11 117,976,985 (GRCm39) missense possibly damaging 0.96
R8710:Dnah17 UTSW 11 117,932,973 (GRCm39) missense probably damaging 1.00
R8713:Dnah17 UTSW 11 117,979,028 (GRCm39) missense probably damaging 1.00
R8722:Dnah17 UTSW 11 117,961,283 (GRCm39) nonsense probably null
R8797:Dnah17 UTSW 11 117,992,201 (GRCm39) missense probably benign 0.00
R8953:Dnah17 UTSW 11 118,016,238 (GRCm39) splice site probably benign
R8965:Dnah17 UTSW 11 117,915,492 (GRCm39) missense probably damaging 1.00
R8976:Dnah17 UTSW 11 117,917,666 (GRCm39) missense probably damaging 1.00
R9090:Dnah17 UTSW 11 117,931,870 (GRCm39) missense probably damaging 1.00
R9128:Dnah17 UTSW 11 117,937,004 (GRCm39) missense possibly damaging 0.76
R9134:Dnah17 UTSW 11 117,978,972 (GRCm39) missense probably damaging 1.00
R9245:Dnah17 UTSW 11 118,016,503 (GRCm39) missense probably benign 0.02
R9251:Dnah17 UTSW 11 118,012,618 (GRCm39) missense probably benign 0.03
R9271:Dnah17 UTSW 11 117,931,870 (GRCm39) missense probably damaging 1.00
R9367:Dnah17 UTSW 11 118,012,212 (GRCm39) missense possibly damaging 0.93
R9367:Dnah17 UTSW 11 117,987,464 (GRCm39) missense possibly damaging 0.95
R9381:Dnah17 UTSW 11 117,914,219 (GRCm39) missense probably benign
R9405:Dnah17 UTSW 11 118,009,737 (GRCm39) missense probably benign
R9449:Dnah17 UTSW 11 117,987,452 (GRCm39) missense probably benign 0.07
R9517:Dnah17 UTSW 11 117,915,440 (GRCm39) missense possibly damaging 0.76
R9588:Dnah17 UTSW 11 118,012,783 (GRCm39) missense probably benign 0.00
R9629:Dnah17 UTSW 11 117,979,804 (GRCm39) missense probably damaging 1.00
R9654:Dnah17 UTSW 11 117,927,156 (GRCm39) critical splice donor site probably null
R9655:Dnah17 UTSW 11 117,971,649 (GRCm39) missense possibly damaging 0.94
R9662:Dnah17 UTSW 11 117,925,166 (GRCm39) missense probably damaging 0.97
R9686:Dnah17 UTSW 11 117,979,048 (GRCm39) missense possibly damaging 0.46
R9689:Dnah17 UTSW 11 117,963,731 (GRCm39) missense probably damaging 1.00
R9706:Dnah17 UTSW 11 118,017,026 (GRCm39) missense probably damaging 1.00
X0058:Dnah17 UTSW 11 117,973,751 (GRCm39) missense probably damaging 1.00
Z1176:Dnah17 UTSW 11 118,017,992 (GRCm39) missense probably benign 0.01
Z1177:Dnah17 UTSW 11 117,977,786 (GRCm39) missense probably damaging 1.00
Z1177:Dnah17 UTSW 11 117,969,389 (GRCm39) missense possibly damaging 0.91
Z1177:Dnah17 UTSW 11 118,017,968 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTACATGCTGGAGCCATCACTTG -3'
(R):5'- CTTAACCCTGCCCTTGGAGGAAAC -3'

Sequencing Primer
(F):5'- AACCGCTGAACCCTCTGTG -3'
(R):5'- TTGGAGGAAACTCCCCAGC -3'
Posted On 2014-08-21