Incidental Mutation 'R0632:Hist1h4i'
ID 218791
Institutional Source Beutler Lab
Gene Symbol Hist1h4i
Ensembl Gene ENSMUSG00000060639
Gene Name histone cluster 1, H4i
Synonyms
MMRRC Submission 038821-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.624) question?
Stock # R0632 (G1)
Quality Score 56
Status Validated
Chromosome 13
Chromosomal Location 22040636-22041362 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 22041027 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 99 (Y99*)
Ref Sequence ENSEMBL: ENSMUSP00000100042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091741] [ENSMUST00000102977] [ENSMUST00000110452] [ENSMUST00000110455]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000091741
SMART Domains Protein: ENSMUSP00000089335
Gene: ENSMUSG00000069301

DomainStartEndE-ValueType
H2A 3 123 8.07e-81 SMART
Predicted Effect probably null
Transcript: ENSMUST00000102977
AA Change: Y99*
SMART Domains Protein: ENSMUSP00000100042
Gene: ENSMUSG00000060639
AA Change: Y99*

DomainStartEndE-ValueType
H4 16 90 2.59e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110452
SMART Domains Protein: ENSMUSP00000106082
Gene: ENSMUSG00000069300

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 4.64e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110455
SMART Domains Protein: ENSMUSP00000106085
Gene: ENSMUSG00000062727

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 4.64e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198508
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 95% (81/85)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H4 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik T C 1: 136,227,618 D83G probably benign Het
Acaa1a T A 9: 119,347,818 probably benign Het
Adgrg7 T A 16: 56,742,589 T462S possibly damaging Het
Akap6 A T 12: 52,937,148 N825I probably damaging Het
Ankib1 T A 5: 3,772,529 N59I probably benign Het
Anks6 T C 4: 47,033,167 S633G possibly damaging Het
Ap4e1 C A 2: 127,049,280 Y522* probably null Het
Art5 G A 7: 102,097,957 T205I probably damaging Het
Ascc2 T A 11: 4,649,855 L176H probably damaging Het
Atp13a5 T C 16: 29,298,208 D529G probably benign Het
C2cd4a T C 9: 67,831,563 E66G probably benign Het
C8a T C 4: 104,856,492 D147G probably damaging Het
Ccdc109b T C 3: 129,918,726 M167V probably benign Het
Ccdc14 T C 16: 34,721,649 V532A possibly damaging Het
Ccdc88a T A 11: 29,482,749 probably benign Het
Cfap54 C T 10: 92,885,096 E2543K unknown Het
Cldn13 C T 5: 134,914,747 E195K probably benign Het
Cp A G 3: 19,971,082 S402G probably null Het
Cpa3 T C 3: 20,225,194 T194A probably benign Het
Crygf C A 1: 65,927,997 Y93* probably null Het
Ctsh A G 9: 90,061,582 R87G possibly damaging Het
Cyp2t4 A G 7: 27,158,246 D428G possibly damaging Het
Dnah17 C G 11: 118,067,682 probably benign Het
Dnah3 A G 7: 119,967,905 V2366A probably benign Het
Dscaml1 A T 9: 45,732,134 I1284F probably benign Het
Dsg1c T C 18: 20,272,346 probably benign Het
Dst G T 1: 34,271,413 R4098L probably damaging Het
Efhb A G 17: 53,413,459 probably benign Het
Epha7 A T 4: 28,821,104 I90F probably damaging Het
Fam171a2 T A 11: 102,437,881 D684V probably damaging Het
Fan1 A G 7: 64,363,199 V665A possibly damaging Het
Fbn2 A G 18: 58,037,747 C2191R probably damaging Het
Fkbp3 G A 12: 65,073,918 A2V probably benign Het
G6pd2 A G 5: 61,810,171 N430D probably benign Het
Gm13119 G A 4: 144,363,782 C464Y probably damaging Het
Gm13547 T A 2: 29,761,584 D7E possibly damaging Het
Hdac5 A T 11: 102,205,812 D260E probably damaging Het
Hsf2bp T C 17: 32,013,346 E142G probably damaging Het
Igf1r C T 7: 68,165,155 T268I probably damaging Het
Kcne3 C T 7: 100,184,439 R88C probably damaging Het
Klk1b9 G T 7: 43,979,372 G100V possibly damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lama1 C T 17: 67,752,368 probably benign Het
Lcp2 C T 11: 34,082,426 P335S possibly damaging Het
Lrrk2 T A 15: 91,796,028 N2047K probably damaging Het
Mia2 T C 12: 59,136,143 L36P probably damaging Het
Mmp13 A T 9: 7,282,077 I460F possibly damaging Het
Mmp13 G A 9: 7,274,032 G169R probably damaging Het
Msh4 A G 3: 153,896,895 I232T probably damaging Het
Msra T A 14: 64,210,532 M145L probably benign Het
Myo7a A T 7: 98,112,150 probably benign Het
Nme8 A T 13: 19,658,036 N422K probably damaging Het
Nol6 A T 4: 41,121,115 F353I probably damaging Het
Nphp3 A G 9: 104,018,274 K384E probably damaging Het
Olfr572 C T 7: 102,928,604 probably null Het
Olfr652 A G 7: 104,564,337 I39V probably benign Het
Olfr672 A G 7: 104,996,703 I67T probably benign Het
Phox2b T G 5: 67,096,214 probably benign Het
Plec A T 15: 76,173,411 S4131T probably damaging Het
Pptc7 G A 5: 122,313,591 probably benign Het
Prpf40b A G 15: 99,316,289 E810G probably benign Het
Ptprc C T 1: 138,073,610 V965I probably benign Het
Pum1 T A 4: 130,728,104 M180K probably benign Het
Ranbp3 T C 17: 56,702,896 probably benign Het
Rasgrf2 A G 13: 91,972,274 S787P probably benign Het
Rnf19b T A 4: 129,073,551 N294K probably damaging Het
Samd3 A T 10: 26,244,495 H156L possibly damaging Het
Serpinb6c C T 13: 33,880,031 R347Q possibly damaging Het
Slc36a3 A G 11: 55,125,080 I416T probably damaging Het
Slc4a4 T A 5: 89,129,641 F279Y probably damaging Het
Slc6a2 T A 8: 92,992,801 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tab2 A G 10: 7,919,801 S232P probably benign Het
Tacc2 A T 7: 130,625,595 K1356* probably null Het
Tmem87a A G 2: 120,359,542 S544P probably damaging Het
Trim52 T A 14: 106,106,967 C20S probably damaging Het
Usp38 A T 8: 81,014,150 V96E probably benign Het
Vmn2r59 T C 7: 42,058,884 Y33C probably damaging Het
Vsig10l T G 7: 43,464,137 V171G probably damaging Het
Zfp957 T A 14: 79,212,920 I480F probably damaging Het
Other mutations in Hist1h4i
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0676:Hist1h4i UTSW 13 22041106 splice site probably null
R4955:Hist1h4i UTSW 13 22041185 missense probably damaging 1.00
R6174:Hist1h4i UTSW 13 22041077 missense probably benign 0.41
R7556:Hist1h4i UTSW 13 22041244 missense probably damaging 1.00
Z1176:Hist1h4i UTSW 13 22041214 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCCCAAGCAGAAGGCTCTATTG -3'
(R):5'- TCCGGTCCGCAAGTTCCCTATAAG -3'

Sequencing Primer
(F):5'- gcacgcctttaatcccaac -3'
(R):5'- AGTGCTTCGGGACAACATC -3'
Posted On 2014-08-21