Incidental Mutation 'R0658:Slc9a1'
ID218794
Institutional Source Beutler Lab
Gene Symbol Slc9a1
Ensembl Gene ENSMUSG00000028854
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 1
SynonymsApnh, Nhe1, antiporter
MMRRC Submission 038843-MU
Accession Numbers

Genbank: NM_016981; MGI: 102462

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0658 (G1)
Quality Score42
Status Validated
Chromosome4
Chromosomal Location133369706-133423702 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 133420499 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030669]
Predicted Effect probably benign
Transcript: ENSMUST00000030669
SMART Domains Protein: ENSMUSP00000030669
Gene: ENSMUSG00000028854

DomainStartEndE-ValueType
transmembrane domain 15 33 N/A INTRINSIC
Pfam:Na_H_Exchanger 109 509 1.3e-89 PFAM
Pfam:NEXCaM_BD 603 704 1.5e-34 PFAM
low complexity region 757 764 N/A INTRINSIC
low complexity region 803 814 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132864
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156079
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Na+/H+ antiporter that is a member of the solute carrier family 9. The encoded protein is a plasma membrane transporter that is expressed in the kidney and intestine. This protein plays a central role in regulating pH homeostasis, cell migration and cell volume. This protein may also be involved in tumor growth. [provided by RefSeq, Sep 2011]
PHENOTYPE: Two-thirds of homozygous null mice die before weaning with reduced body weight, ataxia, a relatively mild stomach phenotype, and a postmortem appearance suggestive of death by a convulsive seizure. Homozygotes also display impaired fluid secretion and NaCl absorption in their parotid glands. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(6) Spontaneous(1)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 C T 5: 100,817,961 probably null Het
Acsl3 A G 1: 78,701,287 D520G probably damaging Het
Adgrl3 T C 5: 81,648,713 V623A probably benign Het
Ak9 G T 10: 41,347,222 V454L probably damaging Het
Alpk2 C A 18: 65,349,487 K483N probably damaging Het
Arhgef12 T C 9: 42,981,985 Y974C probably damaging Het
Armc8 C T 9: 99,536,158 probably benign Het
Atp2a2 C T 5: 122,457,633 probably benign Het
Atrn T C 2: 130,970,227 probably null Het
Caps2 T A 10: 112,204,038 probably benign Het
Cep76 A G 18: 67,623,304 S486P probably damaging Het
Cep97 C T 16: 55,914,902 R583H probably benign Het
Cog7 A G 7: 121,956,140 probably benign Het
Commd5 T A 15: 76,900,568 V55E probably damaging Het
Csmd3 A T 15: 48,011,147 D684E possibly damaging Het
Ctxn2 T C 2: 125,147,456 M1T probably null Het
Exph5 A G 9: 53,377,475 D1952G unknown Het
Fmo2 A T 1: 162,876,774 L521Q possibly damaging Het
Fryl T A 5: 73,065,359 T1960S probably damaging Het
G6pd2 T C 5: 61,809,674 L264P probably damaging Het
Gm1966 C A 7: 106,602,886 V384L possibly damaging Het
Gne A T 4: 44,039,033 V647E possibly damaging Het
Grb14 G A 2: 64,914,727 Q96* probably null Het
Gtf3c1 A G 7: 125,698,962 F146L probably damaging Het
Irak2 A G 6: 113,638,564 Y6C probably damaging Het
Kel T A 6: 41,703,031 N75I probably damaging Het
Lgr4 T A 2: 110,011,787 F706I possibly damaging Het
Lox A T 18: 52,528,883 S149R probably benign Het
Lrrc66 T G 5: 73,610,944 D218A probably benign Het
Luc7l C T 17: 26,266,322 R99W probably damaging Het
Megf10 T C 18: 57,252,896 V327A probably benign Het
Mthfd1l G T 10: 4,047,976 probably null Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myh8 G T 11: 67,284,532 probably null Het
Olfr1463 A T 19: 13,235,060 D270V possibly damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pgf C T 12: 85,169,385 R153K probably benign Het
Pramef8 A T 4: 143,417,600 Q172L probably damaging Het
Prdm2 A G 4: 143,135,265 V485A probably damaging Het
Rag1 T C 2: 101,642,683 T705A probably damaging Het
Rflna A C 5: 125,003,710 D48A possibly damaging Het
Rnf148 A T 6: 23,654,457 I180N probably damaging Het
Rtn4 T A 11: 29,706,475 S94T probably damaging Het
Scn11a G A 9: 119,811,160 T223I probably benign Het
Scube2 T A 7: 109,837,120 probably benign Het
Sept14 T C 5: 129,697,908 I68V probably benign Het
Sil1 A T 18: 35,266,857 L365Q possibly damaging Het
Sirt1 A G 10: 63,321,736 probably benign Het
Smpdl3a A G 10: 57,811,240 T355A probably damaging Het
Syne2 T C 12: 76,094,336 I6074T probably damaging Het
Thbs2 T A 17: 14,680,325 H540L probably benign Het
Tsc22d4 T C 5: 137,768,021 S450P probably benign Het
Tshr C A 12: 91,538,226 S54* probably null Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Uncx G T 5: 139,544,187 C65F probably damaging Het
Vmn1r87 A T 7: 13,131,829 M177K probably damaging Het
Vmn2r56 A T 7: 12,710,308 C466S probably benign Het
Wnk1 G A 6: 119,948,505 P1831S probably damaging Het
Zfp820 T C 17: 21,818,920 S476G probably benign Het
Other mutations in Slc9a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Slc9a1 APN 4 133370548 missense probably benign 0.03
IGL00949:Slc9a1 APN 4 133416451 missense probably benign 0.03
IGL00952:Slc9a1 APN 4 133416382 missense probably damaging 0.99
IGL01023:Slc9a1 APN 4 133422143 missense probably benign 0.04
IGL01151:Slc9a1 APN 4 133411989 missense probably damaging 1.00
IGL01796:Slc9a1 APN 4 133420093 splice site probably benign
IGL01896:Slc9a1 APN 4 133418059 missense probably damaging 1.00
IGL02621:Slc9a1 APN 4 133370568 missense probably benign
F6893:Slc9a1 UTSW 4 133422146 missense probably benign 0.06
R0123:Slc9a1 UTSW 4 133420605 missense probably benign 0.34
R0134:Slc9a1 UTSW 4 133420605 missense probably benign 0.34
R0225:Slc9a1 UTSW 4 133420605 missense probably benign 0.34
R0759:Slc9a1 UTSW 4 133416403 missense probably damaging 1.00
R0781:Slc9a1 UTSW 4 133370548 missense probably benign 0.03
R1110:Slc9a1 UTSW 4 133370548 missense probably benign 0.03
R1316:Slc9a1 UTSW 4 133422247 missense possibly damaging 0.95
R1637:Slc9a1 UTSW 4 133422223 missense probably benign
R1680:Slc9a1 UTSW 4 133418080 missense probably damaging 1.00
R2050:Slc9a1 UTSW 4 133416334 missense probably benign 0.02
R4279:Slc9a1 UTSW 4 133412089 missense probably benign 0.31
R4960:Slc9a1 UTSW 4 133370656 missense probably damaging 1.00
R5381:Slc9a1 UTSW 4 133422071 missense probably damaging 0.96
R5590:Slc9a1 UTSW 4 133421563 missense probably damaging 0.99
R5638:Slc9a1 UTSW 4 133412260 missense probably damaging 1.00
R5935:Slc9a1 UTSW 4 133419865 intron probably benign
R6334:Slc9a1 UTSW 4 133422208 missense possibly damaging 0.64
R6402:Slc9a1 UTSW 4 133370651 missense probably benign 0.37
R7553:Slc9a1 UTSW 4 133412269 missense probably damaging 1.00
R7772:Slc9a1 UTSW 4 133411965 missense probably damaging 1.00
R7843:Slc9a1 UTSW 4 133370442 start gained probably benign
R8268:Slc9a1 UTSW 4 133370623 missense probably benign 0.08
R8359:Slc9a1 UTSW 4 133420616 missense probably damaging 1.00
R8398:Slc9a1 UTSW 4 133419503 missense probably benign 0.05
X0018:Slc9a1 UTSW 4 133418071 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTCTATGCAGTGAGTACCACTGGC -3'
(R):5'- GTGTGTCTGTTATAGGACCGCAGC -3'

Sequencing Primer
(F):5'- AGATCTGGGCAGCATCTCTAC -3'
(R):5'- CTCAGAATCCAGGCTGGGAG -3'
Posted On2014-08-21