Mutagenetix > Incidental Mutation

Incidental Mutation 'R0658:Kel'

218802

Institutional Source

Beutler Lab

Gene Symbol

Kel

Ensembl Gene

ENSMUSG00000029866

Gene Name

Kell blood group

Synonyms

CD238

MMRRC Submission

038843-MU

Accession Numbers

Genbank: NM_032540; MGI: 1346053

Is this an essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R0658 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

41686330-41704339 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 41703031 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 75 (N75I)

Ref Sequence

ENSEMBL: ENSMUSP00000031899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031899]

AlphaFold

Q9EQF2

Predicted Effect

probably damaging
Transcript: ENSMUST00000031899
AA Change: N75I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866
AA Change: N75I

Domain	Start	End	E-Value	Type
transmembrane domain	28	50	N/A	INTRINSIC
Pfam:Peptidase_M13_N	81	463	1.5e-68	PFAM
Pfam:Peptidase_M13	521	712	2.1e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000192118

Meta Mutation Damage Score

0.7485

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

99% (78/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased heart rate, altered hematological parameters and ECG waveform features, decreased erythrocyte Mg2+ and K+ ion content, mild motor deficits, and giant axon changes with varying degrees of paranodal demyelination in the spinal cord and sciatic nerve. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abraxas1	C	T	5: 100,817,961		probably null	Het
Acsl3	A	G	1: 78,701,287	D520G	probably damaging	Het
Adgrl3	T	C	5: 81,648,713	V623A	probably benign	Het
Ak9	G	T	10: 41,347,222	V454L	probably damaging	Het
Alpk2	C	A	18: 65,349,487	K483N	probably damaging	Het
Arhgef12	T	C	9: 42,981,985	Y974C	probably damaging	Het
Armc8	C	T	9: 99,536,158		probably benign	Het
Atp2a2	C	T	5: 122,457,633		probably benign	Het
Atrn	T	C	2: 130,970,227		probably null	Het
Caps2	T	A	10: 112,204,038		probably benign	Het
Cep76	A	G	18: 67,623,304	S486P	probably damaging	Het
Cep97	C	T	16: 55,914,902	R583H	probably benign	Het
Cog7	A	G	7: 121,956,140		probably benign	Het
Commd5	T	A	15: 76,900,568	V55E	probably damaging	Het
Csmd3	A	T	15: 48,011,147	D684E	possibly damaging	Het
Ctxn2	T	C	2: 125,147,456	M1T	probably null	Het
Exph5	A	G	9: 53,377,475	D1952G	unknown	Het
Fmo2	A	T	1: 162,876,774	L521Q	possibly damaging	Het
Fryl	T	A	5: 73,065,359	T1960S	probably damaging	Het
G6pd2	T	C	5: 61,809,674	L264P	probably damaging	Het
Gm1966	C	A	7: 106,602,886	V384L	possibly damaging	Het
Gne	A	T	4: 44,039,033	V647E	possibly damaging	Het
Grb14	G	A	2: 64,914,727	Q96*	probably null	Het
Gtf3c1	A	G	7: 125,698,962	F146L	probably damaging	Het
Irak2	A	G	6: 113,638,564	Y6C	probably damaging	Het
Lgr4	T	A	2: 110,011,787	F706I	possibly damaging	Het
Lox	A	T	18: 52,528,883	S149R	probably benign	Het
Lrrc66	T	G	5: 73,610,944	D218A	probably benign	Het
Luc7l	C	T	17: 26,266,322	R99W	probably damaging	Het
Megf10	T	C	18: 57,252,896	V327A	probably benign	Het
Mthfd1l	G	T	10: 4,047,976		probably null	Het
Myh11	C	A	16: 14,224,019	Q720H	probably damaging	Het
Myh8	G	T	11: 67,284,532		probably null	Het
Olfr1463	A	T	19: 13,235,060	D270V	possibly damaging	Het
Pdia3	G	A	2: 121,432,377	G275S	probably damaging	Het
Pgf	C	T	12: 85,169,385	R153K	probably benign	Het
Pramef8	A	T	4: 143,417,600	Q172L	probably damaging	Het
Prdm2	A	G	4: 143,135,265	V485A	probably damaging	Het
Rag1	T	C	2: 101,642,683	T705A	probably damaging	Het
Rflna	A	C	5: 125,003,710	D48A	possibly damaging	Het
Rnf148	A	T	6: 23,654,457	I180N	probably damaging	Het
Rtn4	T	A	11: 29,706,475	S94T	probably damaging	Het
Scn11a	G	A	9: 119,811,160	T223I	probably benign	Het
Scube2	T	A	7: 109,837,120		probably benign	Het
Sept14	T	C	5: 129,697,908	I68V	probably benign	Het
Sil1	A	T	18: 35,266,857	L365Q	possibly damaging	Het
Sirt1	A	G	10: 63,321,736		probably benign	Het
Slc9a1	T	C	4: 133,420,499		probably benign	Het
Smpdl3a	A	G	10: 57,811,240	T355A	probably damaging	Het
Syne2	T	C	12: 76,094,336	I6074T	probably damaging	Het
Thbs2	T	A	17: 14,680,325	H540L	probably benign	Het
Tsc22d4	T	C	5: 137,768,021	S450P	probably benign	Het
Tshr	C	A	12: 91,538,226	S54*	probably null	Het
Ubxn4	G	A	1: 128,262,904	E256K	probably benign	Het
Uncx	G	T	5: 139,544,187	C65F	probably damaging	Het
Vmn1r87	A	T	7: 13,131,829	M177K	probably damaging	Het
Vmn2r56	A	T	7: 12,710,308	C466S	probably benign	Het
Wnk1	G	A	6: 119,948,505	P1831S	probably damaging	Het
Zfp820	T	C	17: 21,818,920	S476G	probably benign	Het

Other mutations in Kel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Kel	APN	6	41688575	missense	probably damaging	1.00
IGL00792:Kel	APN	6	41702012	missense	probably damaging	1.00
IGL00972:Kel	APN	6	41688066	missense	possibly damaging	0.62
IGL01121:Kel	APN	6	41702409	missense	probably benign	0.00
IGL01286:Kel	APN	6	41688117	splice site	probably null
IGL01461:Kel	APN	6	41701911	critical splice donor site	probably null
IGL01836:Kel	APN	6	41697438	missense	possibly damaging	0.50
IGL02037:Kel	APN	6	41697474	missense	probably benign	0.01
IGL02103:Kel	APN	6	41702389	missense	probably benign	0.18
IGL02604:Kel	APN	6	41687582	missense	probably damaging	0.98
IGL03102:Kel	APN	6	41702983	missense	probably benign	0.00
IGL03274:Kel	APN	6	41687995	splice site	probably null
IGL03355:Kel	APN	6	41698887	critical splice donor site	probably null
A4554:Kel	UTSW	6	41697419	missense	possibly damaging	0.95
R0121:Kel	UTSW	6	41702064	unclassified	probably benign
R0153:Kel	UTSW	6	41701943	missense	probably benign	0.08
R0535:Kel	UTSW	6	41690838	missense	probably null	0.21
R1005:Kel	UTSW	6	41688617	missense	probably damaging	1.00
R1199:Kel	UTSW	6	41688591	missense	possibly damaging	0.95
R1272:Kel	UTSW	6	41703470	missense	probably benign	0.00
R1531:Kel	UTSW	6	41688626	missense	probably damaging	0.99
R1880:Kel	UTSW	6	41687545	missense	possibly damaging	0.95
R2102:Kel	UTSW	6	41686484	missense	possibly damaging	0.86
R2118:Kel	UTSW	6	41689300	missense	probably benign
R2571:Kel	UTSW	6	41688067	missense	possibly damaging	0.62
R4209:Kel	UTSW	6	41698425	nonsense	probably null
R4210:Kel	UTSW	6	41698425	nonsense	probably null
R4260:Kel	UTSW	6	41686423	utr 3 prime	probably benign
R4382:Kel	UTSW	6	41698400	missense	probably benign	0.13
R5023:Kel	UTSW	6	41688111	missense	probably damaging	1.00
R5033:Kel	UTSW	6	41699055	missense	probably damaging	1.00
R5239:Kel	UTSW	6	41688114	nonsense	probably null
R5431:Kel	UTSW	6	41698420	missense	probably benign	0.23
R5742:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5745:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5746:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5978:Kel	UTSW	6	41688045	missense	probably benign	0.00
R6023:Kel	UTSW	6	41697475	missense	probably benign
R6109:Kel	UTSW	6	41688862	missense	probably benign	0.06
R6125:Kel	UTSW	6	41690786	missense	probably damaging	1.00
R6319:Kel	UTSW	6	41702447	missense	probably benign	0.05
R6368:Kel	UTSW	6	41688851	nonsense	probably null
R6864:Kel	UTSW	6	41703760	critical splice donor site	probably null
R6956:Kel	UTSW	6	41687973	missense	probably damaging	1.00
R7644:Kel	UTSW	6	41690808	missense	probably benign	0.03
R7938:Kel	UTSW	6	41698376	missense	probably benign	0.06
R8028:Kel	UTSW	6	41699024	missense	probably benign	0.21
R8082:Kel	UTSW	6	41703490	missense	possibly damaging	0.94
R8465:Kel	UTSW	6	41689538	critical splice donor site	probably null
R9158:Kel	UTSW	6	41687971	missense	probably benign	0.10
R9518:Kel	UTSW	6	41702400	missense	probably damaging	1.00
X0028:Kel	UTSW	6	41698351	missense	probably damaging	0.99
Z1176:Kel	UTSW	6	41687572	missense	probably damaging	1.00
Z1177:Kel	UTSW	6	41689559	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGGTTCAGCTTGACAGCAGGATAG -3'
(R):5'- TGCACCTCACTAAAAGTCCTTTGCC -3'

Sequencing Primer
(F):5'- CTTGACAGCAGGATAGATGAGC -3'
(R):5'- TAAAAGTCCTTTGCCAGCCC -3'

Posted On

2014-08-21