Incidental Mutation 'R0658:Kel'
ID218802
Institutional Source Beutler Lab
Gene Symbol Kel
Ensembl Gene ENSMUSG00000029866
Gene NameKell blood group
SynonymsCD238
MMRRC Submission 038843-MU
Accession Numbers

Genbank: NM_032540; MGI: 1346053

Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0658 (G1)
Quality Score63
Status Validated
Chromosome6
Chromosomal Location41686330-41704339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41703031 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 75 (N75I)
Ref Sequence ENSEMBL: ENSMUSP00000031899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031899]
Predicted Effect probably damaging
Transcript: ENSMUST00000031899
AA Change: N75I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866
AA Change: N75I

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:Peptidase_M13_N 81 463 1.5e-68 PFAM
Pfam:Peptidase_M13 521 712 2.1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192118
Meta Mutation Damage Score 0.7485 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased heart rate, altered hematological parameters and ECG waveform features, decreased erythrocyte Mg2+ and K+ ion content, mild motor deficits, and giant axon changes with varying degrees of paranodal demyelination in the spinal cord and sciatic nerve. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 C T 5: 100,817,961 probably null Het
Acsl3 A G 1: 78,701,287 D520G probably damaging Het
Adgrl3 T C 5: 81,648,713 V623A probably benign Het
Ak9 G T 10: 41,347,222 V454L probably damaging Het
Alpk2 C A 18: 65,349,487 K483N probably damaging Het
Arhgef12 T C 9: 42,981,985 Y974C probably damaging Het
Armc8 C T 9: 99,536,158 probably benign Het
Atp2a2 C T 5: 122,457,633 probably benign Het
Atrn T C 2: 130,970,227 probably null Het
Caps2 T A 10: 112,204,038 probably benign Het
Cep76 A G 18: 67,623,304 S486P probably damaging Het
Cep97 C T 16: 55,914,902 R583H probably benign Het
Cog7 A G 7: 121,956,140 probably benign Het
Commd5 T A 15: 76,900,568 V55E probably damaging Het
Csmd3 A T 15: 48,011,147 D684E possibly damaging Het
Ctxn2 T C 2: 125,147,456 M1T probably null Het
Exph5 A G 9: 53,377,475 D1952G unknown Het
Fmo2 A T 1: 162,876,774 L521Q possibly damaging Het
Fryl T A 5: 73,065,359 T1960S probably damaging Het
G6pd2 T C 5: 61,809,674 L264P probably damaging Het
Gm1966 C A 7: 106,602,886 V384L possibly damaging Het
Gne A T 4: 44,039,033 V647E possibly damaging Het
Grb14 G A 2: 64,914,727 Q96* probably null Het
Gtf3c1 A G 7: 125,698,962 F146L probably damaging Het
Irak2 A G 6: 113,638,564 Y6C probably damaging Het
Lgr4 T A 2: 110,011,787 F706I possibly damaging Het
Lox A T 18: 52,528,883 S149R probably benign Het
Lrrc66 T G 5: 73,610,944 D218A probably benign Het
Luc7l C T 17: 26,266,322 R99W probably damaging Het
Megf10 T C 18: 57,252,896 V327A probably benign Het
Mthfd1l G T 10: 4,047,976 probably null Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myh8 G T 11: 67,284,532 probably null Het
Olfr1463 A T 19: 13,235,060 D270V possibly damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pgf C T 12: 85,169,385 R153K probably benign Het
Pramef8 A T 4: 143,417,600 Q172L probably damaging Het
Prdm2 A G 4: 143,135,265 V485A probably damaging Het
Rag1 T C 2: 101,642,683 T705A probably damaging Het
Rflna A C 5: 125,003,710 D48A possibly damaging Het
Rnf148 A T 6: 23,654,457 I180N probably damaging Het
Rtn4 T A 11: 29,706,475 S94T probably damaging Het
Scn11a G A 9: 119,811,160 T223I probably benign Het
Scube2 T A 7: 109,837,120 probably benign Het
Sept14 T C 5: 129,697,908 I68V probably benign Het
Sil1 A T 18: 35,266,857 L365Q possibly damaging Het
Sirt1 A G 10: 63,321,736 probably benign Het
Slc9a1 T C 4: 133,420,499 probably benign Het
Smpdl3a A G 10: 57,811,240 T355A probably damaging Het
Syne2 T C 12: 76,094,336 I6074T probably damaging Het
Thbs2 T A 17: 14,680,325 H540L probably benign Het
Tsc22d4 T C 5: 137,768,021 S450P probably benign Het
Tshr C A 12: 91,538,226 S54* probably null Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Uncx G T 5: 139,544,187 C65F probably damaging Het
Vmn1r87 A T 7: 13,131,829 M177K probably damaging Het
Vmn2r56 A T 7: 12,710,308 C466S probably benign Het
Wnk1 G A 6: 119,948,505 P1831S probably damaging Het
Zfp820 T C 17: 21,818,920 S476G probably benign Het
Other mutations in Kel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Kel APN 6 41688575 missense probably damaging 1.00
IGL00792:Kel APN 6 41702012 missense probably damaging 1.00
IGL00972:Kel APN 6 41688066 missense possibly damaging 0.62
IGL01121:Kel APN 6 41702409 missense probably benign 0.00
IGL01286:Kel APN 6 41688117 splice site probably null
IGL01461:Kel APN 6 41701911 critical splice donor site probably null
IGL01836:Kel APN 6 41697438 missense possibly damaging 0.50
IGL02037:Kel APN 6 41697474 missense probably benign 0.01
IGL02103:Kel APN 6 41702389 missense probably benign 0.18
IGL02604:Kel APN 6 41687582 missense probably damaging 0.98
IGL03102:Kel APN 6 41702983 missense probably benign 0.00
IGL03274:Kel APN 6 41687995 unclassified probably null
IGL03355:Kel APN 6 41698887 critical splice donor site probably null
A4554:Kel UTSW 6 41697419 missense possibly damaging 0.95
R0121:Kel UTSW 6 41702064 unclassified probably benign
R0153:Kel UTSW 6 41701943 missense probably benign 0.08
R0535:Kel UTSW 6 41690838 missense probably null 0.21
R1005:Kel UTSW 6 41688617 missense probably damaging 1.00
R1199:Kel UTSW 6 41688591 missense possibly damaging 0.95
R1272:Kel UTSW 6 41703470 missense probably benign 0.00
R1531:Kel UTSW 6 41688626 missense probably damaging 0.99
R1880:Kel UTSW 6 41687545 missense possibly damaging 0.95
R2102:Kel UTSW 6 41686484 missense possibly damaging 0.86
R2118:Kel UTSW 6 41689300 missense probably benign
R2571:Kel UTSW 6 41688067 missense possibly damaging 0.62
R4209:Kel UTSW 6 41698425 nonsense probably null
R4210:Kel UTSW 6 41698425 nonsense probably null
R4260:Kel UTSW 6 41686423 utr 3 prime probably benign
R4382:Kel UTSW 6 41698400 missense probably benign 0.13
R5023:Kel UTSW 6 41688111 missense probably damaging 1.00
R5033:Kel UTSW 6 41699055 missense probably damaging 1.00
R5239:Kel UTSW 6 41688114 nonsense probably null
R5431:Kel UTSW 6 41698420 missense probably benign 0.23
R5742:Kel UTSW 6 41699027 missense probably damaging 1.00
R5745:Kel UTSW 6 41699027 missense probably damaging 1.00
R5746:Kel UTSW 6 41699027 missense probably damaging 1.00
R5978:Kel UTSW 6 41688045 missense probably benign 0.00
R6023:Kel UTSW 6 41697475 missense probably benign
R6109:Kel UTSW 6 41688862 missense probably benign 0.06
R6125:Kel UTSW 6 41690786 missense probably damaging 1.00
R6319:Kel UTSW 6 41702447 missense probably benign 0.05
R6368:Kel UTSW 6 41688851 nonsense probably null
R6864:Kel UTSW 6 41703760 critical splice donor site probably null
R6956:Kel UTSW 6 41687973 missense probably damaging 1.00
R7644:Kel UTSW 6 41690808 missense probably benign 0.03
X0028:Kel UTSW 6 41698351 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGTTCAGCTTGACAGCAGGATAG -3'
(R):5'- TGCACCTCACTAAAAGTCCTTTGCC -3'

Sequencing Primer
(F):5'- CTTGACAGCAGGATAGATGAGC -3'
(R):5'- TAAAAGTCCTTTGCCAGCCC -3'
Posted On2014-08-21