Incidental Mutation 'R0658:Scube2'
ID218805
Institutional Source Beutler Lab
Gene Symbol Scube2
Ensembl Gene ENSMUSG00000007279
Gene Namesignal peptide, CUB domain, EGF-like 2
SynonymsICRFP703N2430Q5.1, 4932442O19Rik, Cegf1, ICRFP703B1614Q5.1
MMRRC Submission 038843-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.422) question?
Stock #R0658 (G1)
Quality Score63
Status Validated
Chromosome7
Chromosomal Location109798676-109865679 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 109837120 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007423] [ENSMUST00000106728] [ENSMUST00000106729]
Predicted Effect probably benign
Transcript: ENSMUST00000007423
SMART Domains Protein: ENSMUSP00000007423
Gene: ENSMUSG00000007279

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 479 490 N/A INTRINSIC
low complexity region 577 594 N/A INTRINSIC
Pfam:GCC2_GCC3 642 692 7.2e-19 PFAM
Pfam:GCC2_GCC3 699 746 2e-16 PFAM
Pfam:GCC2_GCC3 755 802 3.1e-18 PFAM
CUB 807 919 1.23e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106728
SMART Domains Protein: ENSMUSP00000102339
Gene: ENSMUSG00000007279

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 451 468 N/A INTRINSIC
Pfam:GCC2_GCC3 516 566 6.4e-17 PFAM
Pfam:GCC2_GCC3 573 620 3.5e-14 PFAM
Pfam:GCC2_GCC3 629 676 5.4e-16 PFAM
Blast:CUB 678 727 2e-25 BLAST
Blast:CUB 730 796 1e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106729
SMART Domains Protein: ENSMUSP00000102340
Gene: ENSMUSG00000007279

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 605 622 N/A INTRINSIC
Pfam:GCC2_GCC3 670 717 1.8e-16 PFAM
Pfam:GCC2_GCC3 726 773 2.7e-18 PFAM
CUB 778 890 1.23e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132113
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 99% (78/79)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are smaller than controls. Mice also exhibit defective endochondral bone formation and impaired Ihh-mediated chondrocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 C T 5: 100,817,961 probably null Het
Acsl3 A G 1: 78,701,287 D520G probably damaging Het
Adgrl3 T C 5: 81,648,713 V623A probably benign Het
Ak9 G T 10: 41,347,222 V454L probably damaging Het
Alpk2 C A 18: 65,349,487 K483N probably damaging Het
Arhgef12 T C 9: 42,981,985 Y974C probably damaging Het
Armc8 C T 9: 99,536,158 probably benign Het
Atp2a2 C T 5: 122,457,633 probably benign Het
Atrn T C 2: 130,970,227 probably null Het
Caps2 T A 10: 112,204,038 probably benign Het
Cep76 A G 18: 67,623,304 S486P probably damaging Het
Cep97 C T 16: 55,914,902 R583H probably benign Het
Cog7 A G 7: 121,956,140 probably benign Het
Commd5 T A 15: 76,900,568 V55E probably damaging Het
Csmd3 A T 15: 48,011,147 D684E possibly damaging Het
Ctxn2 T C 2: 125,147,456 M1T probably null Het
Exph5 A G 9: 53,377,475 D1952G unknown Het
Fmo2 A T 1: 162,876,774 L521Q possibly damaging Het
Fryl T A 5: 73,065,359 T1960S probably damaging Het
G6pd2 T C 5: 61,809,674 L264P probably damaging Het
Gm1966 C A 7: 106,602,886 V384L possibly damaging Het
Gne A T 4: 44,039,033 V647E possibly damaging Het
Grb14 G A 2: 64,914,727 Q96* probably null Het
Gtf3c1 A G 7: 125,698,962 F146L probably damaging Het
Irak2 A G 6: 113,638,564 Y6C probably damaging Het
Kel T A 6: 41,703,031 N75I probably damaging Het
Lgr4 T A 2: 110,011,787 F706I possibly damaging Het
Lox A T 18: 52,528,883 S149R probably benign Het
Lrrc66 T G 5: 73,610,944 D218A probably benign Het
Luc7l C T 17: 26,266,322 R99W probably damaging Het
Megf10 T C 18: 57,252,896 V327A probably benign Het
Mthfd1l G T 10: 4,047,976 probably null Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Myh8 G T 11: 67,284,532 probably null Het
Olfr1463 A T 19: 13,235,060 D270V possibly damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pgf C T 12: 85,169,385 R153K probably benign Het
Pramef8 A T 4: 143,417,600 Q172L probably damaging Het
Prdm2 A G 4: 143,135,265 V485A probably damaging Het
Rag1 T C 2: 101,642,683 T705A probably damaging Het
Rflna A C 5: 125,003,710 D48A possibly damaging Het
Rnf148 A T 6: 23,654,457 I180N probably damaging Het
Rtn4 T A 11: 29,706,475 S94T probably damaging Het
Scn11a G A 9: 119,811,160 T223I probably benign Het
Sept14 T C 5: 129,697,908 I68V probably benign Het
Sil1 A T 18: 35,266,857 L365Q possibly damaging Het
Sirt1 A G 10: 63,321,736 probably benign Het
Slc9a1 T C 4: 133,420,499 probably benign Het
Smpdl3a A G 10: 57,811,240 T355A probably damaging Het
Syne2 T C 12: 76,094,336 I6074T probably damaging Het
Thbs2 T A 17: 14,680,325 H540L probably benign Het
Tsc22d4 T C 5: 137,768,021 S450P probably benign Het
Tshr C A 12: 91,538,226 S54* probably null Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Uncx G T 5: 139,544,187 C65F probably damaging Het
Vmn1r87 A T 7: 13,131,829 M177K probably damaging Het
Vmn2r56 A T 7: 12,710,308 C466S probably benign Het
Wnk1 G A 6: 119,948,505 P1831S probably damaging Het
Zfp820 T C 17: 21,818,920 S476G probably benign Het
Other mutations in Scube2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Scube2 APN 7 109808454 missense probably damaging 1.00
IGL01608:Scube2 APN 7 109843254 missense probably benign
IGL02080:Scube2 APN 7 109852478 missense probably damaging 1.00
PIT4445001:Scube2 UTSW 7 109809180 missense probably benign 0.22
R0020:Scube2 UTSW 7 109830888 splice site probably benign
R0020:Scube2 UTSW 7 109830888 splice site probably benign
R0106:Scube2 UTSW 7 109846908 splice site probably benign
R0230:Scube2 UTSW 7 109824764 critical splice donor site probably null
R0255:Scube2 UTSW 7 109824872 missense probably damaging 0.98
R0427:Scube2 UTSW 7 109824837 missense probably benign 0.00
R0612:Scube2 UTSW 7 109804764 splice site probably benign
R0687:Scube2 UTSW 7 109829128 missense possibly damaging 0.47
R1087:Scube2 UTSW 7 109831675 missense probably damaging 1.00
R1366:Scube2 UTSW 7 109804614 missense probably damaging 1.00
R1635:Scube2 UTSW 7 109843214 missense possibly damaging 0.90
R1797:Scube2 UTSW 7 109831675 missense probably damaging 1.00
R1972:Scube2 UTSW 7 109809214 missense probably benign 0.16
R2080:Scube2 UTSW 7 109808505 missense possibly damaging 0.77
R2254:Scube2 UTSW 7 109825459 missense possibly damaging 0.47
R2315:Scube2 UTSW 7 109804701 missense probably damaging 1.00
R2325:Scube2 UTSW 7 109843954 missense probably damaging 1.00
R3723:Scube2 UTSW 7 109808406 splice site probably benign
R3887:Scube2 UTSW 7 109843176 splice site probably benign
R3946:Scube2 UTSW 7 109857590 missense possibly damaging 0.81
R4030:Scube2 UTSW 7 109831771 missense probably benign 0.09
R4621:Scube2 UTSW 7 109800650 missense possibly damaging 0.63
R4684:Scube2 UTSW 7 109810713 missense probably damaging 0.96
R4736:Scube2 UTSW 7 109831205 missense probably benign 0.01
R5096:Scube2 UTSW 7 109799244 utr 3 prime probably benign
R5266:Scube2 UTSW 7 109809230 missense probably damaging 1.00
R5579:Scube2 UTSW 7 109810737 missense probably damaging 1.00
R5669:Scube2 UTSW 7 109825439 missense probably benign 0.04
R5838:Scube2 UTSW 7 109808444 missense probably damaging 1.00
R5916:Scube2 UTSW 7 109831724 missense possibly damaging 0.77
R6056:Scube2 UTSW 7 109833013 nonsense probably null
R6731:Scube2 UTSW 7 109810737 missense probably damaging 1.00
R6785:Scube2 UTSW 7 109810617 missense probably benign
R8197:Scube2 UTSW 7 109808477 missense possibly damaging 0.53
R8250:Scube2 UTSW 7 109864170 missense probably benign 0.20
R8273:Scube2 UTSW 7 109809176 missense probably benign 0.00
R8427:Scube2 UTSW 7 109800590 missense probably damaging 1.00
R8882:Scube2 UTSW 7 109852473 missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109838127 missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109843201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTCCGTTTCAGCACATACCTTG -3'
(R):5'- GACCCTAACGACTTGCTGGTCTTTC -3'

Sequencing Primer
(F):5'- ACATACCTTGGCAAGACTTCTCG -3'
(R):5'- CCATCAGTGAGCATTCTTAAGTGC -3'
Posted On2014-08-21