Incidental Mutation 'R0666:Tdrd9'
ID218837
Institutional Source Beutler Lab
Gene Symbol Tdrd9
Ensembl Gene ENSMUSG00000054003
Gene Nametudor domain containing 9
Synonyms
MMRRC Submission 038851-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R0666 (G1)
Quality Score57
Status Validated
Chromosome12
Chromosomal Location111971559-112068854 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 112007580 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000079009]
Predicted Effect probably benign
Transcript: ENSMUST00000079009
SMART Domains Protein: ENSMUSP00000078022
Gene: ENSMUSG00000054003

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
DEXDc 132 327 5.64e-21 SMART
HELICc 404 502 3.22e-16 SMART
low complexity region 547 561 N/A INTRINSIC
HA2 565 666 1.9e-20 SMART
TUDOR 944 1003 1.52e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191808
Predicted Effect probably benign
Transcript: ENSMUST00000192125
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (89/89)
MGI Phenotype PHENOTYPE: Male homozygous mice are sterile, displaying small testis, arrest of male meiosis and abnormal spermatocyte morphology. Females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T G 11: 78,287,987 M2026R probably damaging Het
2610507B11Rik T A 11: 78,277,212 L1491* probably null Het
Akap6 T A 12: 52,911,808 V782E probably damaging Het
Atg9a A G 1: 75,185,090 L604P probably damaging Het
Atp1a3 T C 7: 24,990,549 I482V probably benign Het
Ccdc105 C A 10: 78,750,547 L223F probably benign Het
Ccdc18 T G 5: 108,163,664 V412G probably benign Het
Cct6a A G 5: 129,794,386 noncoding transcript Het
Clpx A G 9: 65,310,225 N25S probably damaging Het
Cnpy2 T A 10: 128,327,025 C171* probably null Het
Cntnap3 C T 13: 64,757,397 D857N probably damaging Het
Col5a1 A G 2: 28,032,685 Y255C probably damaging Het
Coro7 A T 16: 4,631,911 F638Y possibly damaging Het
Cpd A G 11: 76,782,327 F1331L probably damaging Het
Csmd1 A T 8: 16,069,049 I1842N possibly damaging Het
Dgkg T A 16: 22,562,730 D490V probably damaging Het
Dnah9 A T 11: 66,085,458 M1255K probably benign Het
E2f1 A G 2: 154,560,929 V306A probably benign Het
Entpd1 A G 19: 40,659,906 probably benign Het
Esrrb T A 12: 86,505,902 I222N probably benign Het
Fam159b G T 13: 104,858,354 T95K possibly damaging Het
Flt4 G T 11: 49,625,447 A126S possibly damaging Het
Galnt11 C T 5: 25,252,147 T237I possibly damaging Het
Gbf1 A G 19: 46,262,544 probably benign Het
Gm20388 A T 8: 122,270,988 probably benign Het
Gm7030 T C 17: 36,127,834 T222A possibly damaging Het
Herc1 T A 9: 66,484,888 probably benign Het
Hsph1 T C 5: 149,631,502 Y105C probably damaging Het
Il23r T C 6: 67,434,680 T358A probably benign Het
Il2ra C T 2: 11,643,073 probably benign Het
Kbtbd4 G T 2: 90,914,115 probably benign Het
Kcnt1 A G 2: 25,891,243 probably benign Het
Kng2 A G 16: 22,997,122 probably benign Het
Lap3 C T 5: 45,511,928 T473I possibly damaging Het
Lrrk2 T C 15: 91,757,070 probably null Het
Map1s A G 8: 70,914,052 N534D possibly damaging Het
Mtg1 G A 7: 140,144,344 V122I probably benign Het
Myadm T A 7: 3,297,349 I209K probably damaging Het
Ntsr2 G A 12: 16,653,980 V75I probably benign Het
Olfr1037 G A 2: 86,085,213 A188V probably benign Het
Olfr1272 A T 2: 90,281,868 S236T probably damaging Het
Pfn1 T C 11: 70,654,366 T39A probably benign Het
Pipox T A 11: 77,883,825 K144M probably benign Het
Plekhh1 G A 12: 79,069,115 E811K probably damaging Het
Pnpla3 T A 15: 84,179,305 W295R probably benign Het
Prkacb T A 3: 146,751,518 T136S probably damaging Het
Ralbp1 T A 17: 65,854,129 N473I probably benign Het
Rbp4 G A 19: 38,118,460 T127M probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rps3a1 G A 3: 86,138,117 probably benign Het
Scg3 G T 9: 75,643,940 Y429* probably null Het
Spag5 T C 11: 78,313,396 S492P probably damaging Het
St7 T A 6: 17,934,239 M540K probably damaging Het
Stxbp3 C A 3: 108,805,302 V281F possibly damaging Het
Sun5 A G 2: 153,859,048 V242A possibly damaging Het
Susd5 G T 9: 114,095,784 R245L possibly damaging Het
Syne2 A G 12: 75,923,013 E954G probably damaging Het
Synpo2 A T 3: 123,114,059 V536E probably damaging Het
Tas2r140 T C 6: 133,055,442 I118V probably benign Het
Tbx18 C A 9: 87,724,409 V228L probably benign Het
Tg T C 15: 66,737,521 M310T probably benign Het
Ticam2 T A 18: 46,560,651 D123V probably damaging Het
Timm23 A G 14: 32,199,036 probably benign Het
Tinag C T 9: 77,005,687 R280H probably benign Het
Topbp1 G A 9: 103,308,812 R51K probably benign Het
Tor1b A G 2: 30,953,913 I121V probably damaging Het
Tpmt C A 13: 47,032,454 G148V probably damaging Het
Tubb1 A G 2: 174,457,755 E410G probably damaging Het
Ubash3b C A 9: 41,047,064 V7L possibly damaging Het
Ube2o C T 11: 116,542,835 E686K probably damaging Het
Unc13d T A 11: 116,069,492 probably benign Het
Vmn1r183 A T 7: 24,055,176 M135L probably benign Het
Wisp3 T C 10: 39,151,289 R316G probably benign Het
Xkr8 T C 4: 132,732,338 Y43C probably damaging Het
Zc3h4 T A 7: 16,434,772 N935K unknown Het
Zc3h7a G A 16: 11,156,303 probably benign Het
Zfp84 C T 7: 29,776,851 H323Y probably damaging Het
Zfp873 G T 10: 82,060,761 S442I possibly damaging Het
Zfp938 A G 10: 82,225,772 L338P probably damaging Het
Other mutations in Tdrd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Tdrd9 APN 12 112040434 missense probably damaging 1.00
IGL01373:Tdrd9 APN 12 112040434 missense probably damaging 1.00
IGL01542:Tdrd9 APN 12 112046989 missense possibly damaging 0.94
IGL02967:Tdrd9 APN 12 111992488 missense possibly damaging 0.50
IGL03063:Tdrd9 APN 12 112044299 missense probably benign 0.00
IGL03107:Tdrd9 APN 12 112042840 missense probably damaging 0.98
R0433:Tdrd9 UTSW 12 112025581 nonsense probably null
R0453:Tdrd9 UTSW 12 112068239 missense probably benign
R0655:Tdrd9 UTSW 12 112040465 missense probably damaging 1.00
R1073:Tdrd9 UTSW 12 112023259 missense probably damaging 1.00
R1280:Tdrd9 UTSW 12 112039408 missense probably damaging 1.00
R1386:Tdrd9 UTSW 12 112044804 missense probably benign 0.21
R1521:Tdrd9 UTSW 12 112036410 missense probably damaging 1.00
R1601:Tdrd9 UTSW 12 112023253 nonsense probably null
R1651:Tdrd9 UTSW 12 112024706 missense probably damaging 0.97
R1715:Tdrd9 UTSW 12 112036439 missense possibly damaging 0.62
R1854:Tdrd9 UTSW 12 112044812 missense probably damaging 1.00
R1905:Tdrd9 UTSW 12 112063627 splice site probably benign
R2386:Tdrd9 UTSW 12 112015900 missense probably damaging 1.00
R2863:Tdrd9 UTSW 12 112031261 missense probably benign
R2915:Tdrd9 UTSW 12 112040461 missense probably damaging 1.00
R2958:Tdrd9 UTSW 12 112041672 missense probably damaging 0.97
R4033:Tdrd9 UTSW 12 111992539 missense possibly damaging 0.58
R4087:Tdrd9 UTSW 12 112013486 nonsense probably null
R4237:Tdrd9 UTSW 12 112067625 nonsense probably null
R4482:Tdrd9 UTSW 12 112014501 critical splice donor site probably null
R4501:Tdrd9 UTSW 12 112042809 missense probably benign 0.00
R4502:Tdrd9 UTSW 12 111993825 missense probably damaging 1.00
R4715:Tdrd9 UTSW 12 112041689 missense probably benign 0.00
R4803:Tdrd9 UTSW 12 111996835 nonsense probably null
R5218:Tdrd9 UTSW 12 112063475 intron probably benign
R5275:Tdrd9 UTSW 12 112051912 nonsense probably null
R5295:Tdrd9 UTSW 12 112051912 nonsense probably null
R5301:Tdrd9 UTSW 12 112036529 critical splice donor site probably null
R5339:Tdrd9 UTSW 12 112027122 missense probably damaging 1.00
R5500:Tdrd9 UTSW 12 112023268 missense probably benign 0.02
R5573:Tdrd9 UTSW 12 111997902 synonymous probably null
R5590:Tdrd9 UTSW 12 112051980 missense probably benign 0.01
R5891:Tdrd9 UTSW 12 112042719 missense probably damaging 1.00
R6056:Tdrd9 UTSW 12 111985041 missense probably damaging 1.00
R6057:Tdrd9 UTSW 12 112013286 missense possibly damaging 0.85
R6125:Tdrd9 UTSW 12 112068198 missense possibly damaging 0.89
R6254:Tdrd9 UTSW 12 112025900 splice site probably null
R6335:Tdrd9 UTSW 12 112041752 critical splice donor site probably null
R6345:Tdrd9 UTSW 12 112034608 missense probably damaging 0.99
R6792:Tdrd9 UTSW 12 112027113 missense probably benign 0.01
R6956:Tdrd9 UTSW 12 112036354 splice site probably benign
R6987:Tdrd9 UTSW 12 112025593 missense possibly damaging 0.82
R7090:Tdrd9 UTSW 12 111992470 missense probably benign
R7158:Tdrd9 UTSW 12 112036366 missense probably benign 0.08
R7220:Tdrd9 UTSW 12 112014454 missense probably damaging 1.00
R7478:Tdrd9 UTSW 12 111985042 missense probably damaging 1.00
R7489:Tdrd9 UTSW 12 112067637 missense probably benign 0.00
X0018:Tdrd9 UTSW 12 112039329 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- TGCATTGGAAGTGAAGAGCCCTGG -3'
(R):5'- AACTGTGAAGCAGACAAGCCTGCC -3'

Sequencing Primer
(F):5'- TACCTGACGTGATCTGCAAG -3'
(R):5'- GACAAGCCTGCCTTAAAAAGGTATTC -3'
Posted On2014-08-21