Incidental Mutation 'R0666:Cntnap3'
ID 218839
Institutional Source Beutler Lab
Gene Symbol Cntnap3
Ensembl Gene ENSMUSG00000033063
Gene Name contactin associated protein-like 3
Synonyms
MMRRC Submission 038851-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R0666 (G1)
Quality Score 35
Status Validated
Chromosome 13
Chromosomal Location 64883996-65051769 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 64905211 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 857 (D857N)
Ref Sequence ENSEMBL: ENSMUSP00000089140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091554]
AlphaFold E9PY62
Predicted Effect probably damaging
Transcript: ENSMUST00000091554
AA Change: D857N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: D857N

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FA58C 33 180 4.88e-17 SMART
LamG 207 345 1.47e-11 SMART
LamG 394 525 1.43e-23 SMART
EGF 553 587 1.33e-1 SMART
FBG 590 775 6.76e-1 SMART
LamG 815 942 1.89e-32 SMART
EGF_like 963 999 6.28e1 SMART
LamG 1040 1178 9.46e-15 SMART
transmembrane domain 1245 1267 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222618
Meta Mutation Damage Score 0.1531 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 T A 12: 52,958,591 (GRCm39) V782E probably damaging Het
Atg9a A G 1: 75,161,734 (GRCm39) L604P probably damaging Het
Atp1a3 T C 7: 24,689,974 (GRCm39) I482V probably benign Het
Bltp2 T G 11: 78,178,813 (GRCm39) M2026R probably damaging Het
Bltp2 T A 11: 78,168,038 (GRCm39) L1491* probably null Het
Ccdc18 T G 5: 108,311,530 (GRCm39) V412G probably benign Het
Ccn6 T C 10: 39,027,285 (GRCm39) R316G probably benign Het
Cct6a A G 5: 129,871,449 (GRCm39) noncoding transcript Het
Clpx A G 9: 65,217,507 (GRCm39) N25S probably damaging Het
Cnpy2 T A 10: 128,162,894 (GRCm39) C171* probably null Het
Col5a1 A G 2: 27,922,697 (GRCm39) Y255C probably damaging Het
Coro7 A T 16: 4,449,775 (GRCm39) F638Y possibly damaging Het
Cpd A G 11: 76,673,153 (GRCm39) F1331L probably damaging Het
Csmd1 A T 8: 16,119,063 (GRCm39) I1842N possibly damaging Het
Dgkg T A 16: 22,381,480 (GRCm39) D490V probably damaging Het
Dnah9 A T 11: 65,976,284 (GRCm39) M1255K probably benign Het
E2f1 A G 2: 154,402,849 (GRCm39) V306A probably benign Het
Entpd1 A G 19: 40,648,350 (GRCm39) probably benign Het
Esrrb T A 12: 86,552,676 (GRCm39) I222N probably benign Het
Flt4 G T 11: 49,516,274 (GRCm39) A126S possibly damaging Het
Galnt11 C T 5: 25,457,145 (GRCm39) T237I possibly damaging Het
Galnt2l A T 8: 122,997,727 (GRCm39) probably benign Het
Gbf1 A G 19: 46,250,983 (GRCm39) probably benign Het
H2-T9 T C 17: 36,438,726 (GRCm39) T222A possibly damaging Het
Herc1 T A 9: 66,392,170 (GRCm39) probably benign Het
Hsph1 T C 5: 149,554,967 (GRCm39) Y105C probably damaging Het
Il23r T C 6: 67,411,664 (GRCm39) T358A probably benign Het
Il2ra C T 2: 11,647,884 (GRCm39) probably benign Het
Kbtbd4 G T 2: 90,744,459 (GRCm39) probably benign Het
Kcnt1 A G 2: 25,781,255 (GRCm39) probably benign Het
Kng2 A G 16: 22,815,872 (GRCm39) probably benign Het
Lap3 C T 5: 45,669,270 (GRCm39) T473I possibly damaging Het
Lrrk2 T C 15: 91,641,273 (GRCm39) probably null Het
Map1s A G 8: 71,366,696 (GRCm39) N534D possibly damaging Het
Mtg1 G A 7: 139,724,257 (GRCm39) V122I probably benign Het
Myadm T A 7: 3,345,865 (GRCm39) I209K probably damaging Het
Ntsr2 G A 12: 16,703,981 (GRCm39) V75I probably benign Het
Or4b1b A T 2: 90,112,212 (GRCm39) S236T probably damaging Het
Or8u10 G A 2: 85,915,557 (GRCm39) A188V probably benign Het
Pfn1 T C 11: 70,545,192 (GRCm39) T39A probably benign Het
Pipox T A 11: 77,774,651 (GRCm39) K144M probably benign Het
Plekhh1 G A 12: 79,115,889 (GRCm39) E811K probably damaging Het
Pnpla3 T A 15: 84,063,506 (GRCm39) W295R probably benign Het
Prkacb T A 3: 146,457,273 (GRCm39) T136S probably damaging Het
Ralbp1 T A 17: 66,161,124 (GRCm39) N473I probably benign Het
Rbp4 G A 19: 38,106,908 (GRCm39) T127M probably damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rps3a1 G A 3: 86,045,424 (GRCm39) probably benign Het
Scg3 G T 9: 75,551,222 (GRCm39) Y429* probably null Het
Shisal2b G T 13: 104,994,862 (GRCm39) T95K possibly damaging Het
Spag5 T C 11: 78,204,222 (GRCm39) S492P probably damaging Het
St7 T A 6: 17,934,238 (GRCm39) M540K probably damaging Het
Stxbp3 C A 3: 108,712,618 (GRCm39) V281F possibly damaging Het
Sun5 A G 2: 153,700,968 (GRCm39) V242A possibly damaging Het
Susd5 G T 9: 113,924,852 (GRCm39) R245L possibly damaging Het
Syne2 A G 12: 75,969,787 (GRCm39) E954G probably damaging Het
Synpo2 A T 3: 122,907,708 (GRCm39) V536E probably damaging Het
Tas2r140 T C 6: 133,032,405 (GRCm39) I118V probably benign Het
Tbx18 C A 9: 87,606,462 (GRCm39) V228L probably benign Het
Tdrd9 T A 12: 111,974,014 (GRCm39) probably benign Het
Tektl1 C A 10: 78,586,381 (GRCm39) L223F probably benign Het
Tg T C 15: 66,609,370 (GRCm39) M310T probably benign Het
Ticam2 T A 18: 46,693,718 (GRCm39) D123V probably damaging Het
Timm23 A G 14: 31,920,993 (GRCm39) probably benign Het
Tinag C T 9: 76,912,969 (GRCm39) R280H probably benign Het
Topbp1 G A 9: 103,186,011 (GRCm39) R51K probably benign Het
Tor1b A G 2: 30,843,925 (GRCm39) I121V probably damaging Het
Tpmt C A 13: 47,185,930 (GRCm39) G148V probably damaging Het
Tubb1 A G 2: 174,299,548 (GRCm39) E410G probably damaging Het
Ubash3b C A 9: 40,958,360 (GRCm39) V7L possibly damaging Het
Ube2o C T 11: 116,433,661 (GRCm39) E686K probably damaging Het
Unc13d T A 11: 115,960,318 (GRCm39) probably benign Het
Vmn1r183 A T 7: 23,754,601 (GRCm39) M135L probably benign Het
Xkr8 T C 4: 132,459,649 (GRCm39) Y43C probably damaging Het
Zc3h4 T A 7: 16,168,697 (GRCm39) N935K unknown Het
Zc3h7a G A 16: 10,974,167 (GRCm39) probably benign Het
Zfp84 C T 7: 29,476,276 (GRCm39) H323Y probably damaging Het
Zfp873 G T 10: 81,896,595 (GRCm39) S442I possibly damaging Het
Zfp938 A G 10: 82,061,606 (GRCm39) L338P probably damaging Het
Other mutations in Cntnap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cntnap3 APN 13 64,920,545 (GRCm39) missense probably damaging 1.00
IGL00782:Cntnap3 APN 13 64,893,619 (GRCm39) splice site probably benign
IGL00976:Cntnap3 APN 13 64,942,166 (GRCm39) missense probably damaging 1.00
IGL01319:Cntnap3 APN 13 64,935,651 (GRCm39) missense probably damaging 1.00
IGL01610:Cntnap3 APN 13 64,905,115 (GRCm39) missense probably damaging 0.98
IGL01861:Cntnap3 APN 13 64,946,922 (GRCm39) missense probably damaging 1.00
IGL02127:Cntnap3 APN 13 64,946,878 (GRCm39) splice site probably benign
IGL02133:Cntnap3 APN 13 64,899,487 (GRCm39) splice site probably benign
IGL02251:Cntnap3 APN 13 64,909,850 (GRCm39) missense probably damaging 1.00
IGL02272:Cntnap3 APN 13 64,905,225 (GRCm39) missense probably damaging 1.00
IGL02370:Cntnap3 APN 13 64,899,565 (GRCm39) missense probably benign
IGL02456:Cntnap3 APN 13 64,946,872 (GRCm39) splice site probably benign
IGL02589:Cntnap3 APN 13 64,940,244 (GRCm39) missense probably benign 0.08
IGL02695:Cntnap3 APN 13 64,919,946 (GRCm39) missense probably benign 0.01
IGL02850:Cntnap3 APN 13 64,905,223 (GRCm39) missense probably damaging 1.00
IGL03038:Cntnap3 APN 13 64,888,839 (GRCm39) missense possibly damaging 0.50
IGL03188:Cntnap3 APN 13 64,929,559 (GRCm39) missense probably damaging 0.97
IGL03327:Cntnap3 APN 13 65,035,582 (GRCm39) nonsense probably null
PIT4480001:Cntnap3 UTSW 13 64,905,024 (GRCm39) missense probably damaging 1.00
R0309:Cntnap3 UTSW 13 64,905,250 (GRCm39) splice site probably benign
R0422:Cntnap3 UTSW 13 64,905,099 (GRCm39) missense probably damaging 0.96
R0463:Cntnap3 UTSW 13 64,926,690 (GRCm39) missense probably damaging 1.00
R0491:Cntnap3 UTSW 13 64,909,859 (GRCm39) missense probably benign 0.01
R0499:Cntnap3 UTSW 13 65,006,492 (GRCm39) missense probably benign 0.33
R0550:Cntnap3 UTSW 13 64,909,814 (GRCm39) missense possibly damaging 0.86
R0613:Cntnap3 UTSW 13 64,906,228 (GRCm39) missense probably damaging 1.00
R0840:Cntnap3 UTSW 13 64,935,724 (GRCm39) missense possibly damaging 0.94
R1577:Cntnap3 UTSW 13 64,906,104 (GRCm39) missense probably damaging 1.00
R1716:Cntnap3 UTSW 13 64,909,816 (GRCm39) missense probably damaging 1.00
R1732:Cntnap3 UTSW 13 64,888,626 (GRCm39) critical splice donor site probably null
R1739:Cntnap3 UTSW 13 64,888,406 (GRCm39) missense probably benign 0.17
R1905:Cntnap3 UTSW 13 65,051,578 (GRCm39) missense probably benign 0.04
R1988:Cntnap3 UTSW 13 64,906,204 (GRCm39) missense probably damaging 1.00
R2086:Cntnap3 UTSW 13 64,942,076 (GRCm39) missense possibly damaging 0.76
R3732:Cntnap3 UTSW 13 64,888,813 (GRCm39) missense possibly damaging 0.73
R3808:Cntnap3 UTSW 13 64,929,618 (GRCm39) missense probably damaging 0.96
R3809:Cntnap3 UTSW 13 64,929,618 (GRCm39) missense probably damaging 0.96
R4384:Cntnap3 UTSW 13 64,896,274 (GRCm39) missense probably damaging 1.00
R4433:Cntnap3 UTSW 13 64,926,667 (GRCm39) missense possibly damaging 0.92
R4631:Cntnap3 UTSW 13 64,926,697 (GRCm39) missense probably benign 0.04
R4645:Cntnap3 UTSW 13 64,926,602 (GRCm39) critical splice donor site probably null
R4702:Cntnap3 UTSW 13 64,926,676 (GRCm39) missense probably benign 0.17
R4876:Cntnap3 UTSW 13 64,935,520 (GRCm39) missense probably benign 0.00
R4994:Cntnap3 UTSW 13 64,909,798 (GRCm39) missense possibly damaging 0.55
R5043:Cntnap3 UTSW 13 64,942,162 (GRCm39) missense probably damaging 1.00
R5214:Cntnap3 UTSW 13 64,909,824 (GRCm39) missense probably damaging 1.00
R5403:Cntnap3 UTSW 13 64,909,792 (GRCm39) missense possibly damaging 0.90
R5571:Cntnap3 UTSW 13 65,051,572 (GRCm39) missense probably damaging 0.98
R5587:Cntnap3 UTSW 13 64,894,552 (GRCm39) missense probably damaging 1.00
R5695:Cntnap3 UTSW 13 64,935,769 (GRCm39) missense probably damaging 0.99
R5834:Cntnap3 UTSW 13 64,896,391 (GRCm39) missense probably benign 0.07
R5892:Cntnap3 UTSW 13 64,946,994 (GRCm39) missense probably damaging 1.00
R5950:Cntnap3 UTSW 13 64,935,583 (GRCm39) missense probably damaging 1.00
R6526:Cntnap3 UTSW 13 64,929,702 (GRCm39) missense possibly damaging 0.96
R6954:Cntnap3 UTSW 13 64,896,373 (GRCm39) missense probably benign 0.00
R7138:Cntnap3 UTSW 13 64,929,539 (GRCm39) critical splice donor site probably null
R7355:Cntnap3 UTSW 13 64,919,776 (GRCm39) missense probably benign
R7425:Cntnap3 UTSW 13 64,906,066 (GRCm39) missense probably damaging 1.00
R7521:Cntnap3 UTSW 13 64,919,815 (GRCm39) missense probably benign 0.22
R7719:Cntnap3 UTSW 13 64,920,591 (GRCm39) nonsense probably null
R7810:Cntnap3 UTSW 13 64,941,122 (GRCm39) missense possibly damaging 0.73
R7871:Cntnap3 UTSW 13 65,051,587 (GRCm39) missense probably benign 0.00
R8259:Cntnap3 UTSW 13 64,935,681 (GRCm39) missense probably damaging 0.99
R8415:Cntnap3 UTSW 13 64,886,479 (GRCm39) missense probably benign 0.31
R8491:Cntnap3 UTSW 13 64,933,157 (GRCm39) missense probably damaging 1.00
R9086:Cntnap3 UTSW 13 64,929,573 (GRCm39) missense probably damaging 1.00
R9087:Cntnap3 UTSW 13 64,899,532 (GRCm39) missense probably damaging 0.96
R9398:Cntnap3 UTSW 13 65,051,648 (GRCm39) missense probably benign 0.41
R9475:Cntnap3 UTSW 13 64,946,949 (GRCm39) missense probably damaging 1.00
R9625:Cntnap3 UTSW 13 65,006,579 (GRCm39) missense probably damaging 1.00
R9679:Cntnap3 UTSW 13 64,899,562 (GRCm39) missense probably damaging 1.00
Z1176:Cntnap3 UTSW 13 64,940,202 (GRCm39) missense probably damaging 0.98
Z1176:Cntnap3 UTSW 13 64,888,686 (GRCm39) frame shift probably null
Z1177:Cntnap3 UTSW 13 64,929,706 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATAACAGCACTCACCAATGAAGAGC -3'
(R):5'- TTTGCCCCTCCTCCAACTCAGAG -3'

Sequencing Primer
(F):5'- AGGAGTGGACTGTGTCTTCT -3'
(R):5'- CCAACTCAGAGTCAGATTTTTTTTTC -3'
Posted On 2014-08-21