Mutagenetix > Incidental Mutation

Incidental Mutation 'R0666:Cntnap3'

218839

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

038851-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R0666 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 64757397 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 857 (D857N)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

probably damaging
Transcript: ENSMUST00000091554
AA Change: D857N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: D857N

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222618

Meta Mutation Damage Score

0.1531

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 95.7%

Validation Efficiency

100% (89/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	G	11: 78,287,987	M2026R	probably damaging	Het
2610507B11Rik	T	A	11: 78,277,212	L1491*	probably null	Het
Akap6	T	A	12: 52,911,808	V782E	probably damaging	Het
Atg9a	A	G	1: 75,185,090	L604P	probably damaging	Het
Atp1a3	T	C	7: 24,990,549	I482V	probably benign	Het
Ccdc105	C	A	10: 78,750,547	L223F	probably benign	Het
Ccdc18	T	G	5: 108,163,664	V412G	probably benign	Het
Cct6a	A	G	5: 129,794,386		noncoding transcript	Het
Clpx	A	G	9: 65,310,225	N25S	probably damaging	Het
Cnpy2	T	A	10: 128,327,025	C171*	probably null	Het
Col5a1	A	G	2: 28,032,685	Y255C	probably damaging	Het
Coro7	A	T	16: 4,631,911	F638Y	possibly damaging	Het
Cpd	A	G	11: 76,782,327	F1331L	probably damaging	Het
Csmd1	A	T	8: 16,069,049	I1842N	possibly damaging	Het
Dgkg	T	A	16: 22,562,730	D490V	probably damaging	Het
Dnah9	A	T	11: 66,085,458	M1255K	probably benign	Het
E2f1	A	G	2: 154,560,929	V306A	probably benign	Het
Entpd1	A	G	19: 40,659,906		probably benign	Het
Esrrb	T	A	12: 86,505,902	I222N	probably benign	Het
Fam159b	G	T	13: 104,858,354	T95K	possibly damaging	Het
Flt4	G	T	11: 49,625,447	A126S	possibly damaging	Het
Galnt11	C	T	5: 25,252,147	T237I	possibly damaging	Het
Gbf1	A	G	19: 46,262,544		probably benign	Het
Gm20388	A	T	8: 122,270,988		probably benign	Het
Gm7030	T	C	17: 36,127,834	T222A	possibly damaging	Het
Herc1	T	A	9: 66,484,888		probably benign	Het
Hsph1	T	C	5: 149,631,502	Y105C	probably damaging	Het
Il23r	T	C	6: 67,434,680	T358A	probably benign	Het
Il2ra	C	T	2: 11,643,073		probably benign	Het
Kbtbd4	G	T	2: 90,914,115		probably benign	Het
Kcnt1	A	G	2: 25,891,243		probably benign	Het
Kng2	A	G	16: 22,997,122		probably benign	Het
Lap3	C	T	5: 45,511,928	T473I	possibly damaging	Het
Lrrk2	T	C	15: 91,757,070		probably null	Het
Map1s	A	G	8: 70,914,052	N534D	possibly damaging	Het
Mtg1	G	A	7: 140,144,344	V122I	probably benign	Het
Myadm	T	A	7: 3,297,349	I209K	probably damaging	Het
Ntsr2	G	A	12: 16,653,980	V75I	probably benign	Het
Olfr1037	G	A	2: 86,085,213	A188V	probably benign	Het
Olfr1272	A	T	2: 90,281,868	S236T	probably damaging	Het
Pfn1	T	C	11: 70,654,366	T39A	probably benign	Het
Pipox	T	A	11: 77,883,825	K144M	probably benign	Het
Plekhh1	G	A	12: 79,069,115	E811K	probably damaging	Het
Pnpla3	T	A	15: 84,179,305	W295R	probably benign	Het
Prkacb	T	A	3: 146,751,518	T136S	probably damaging	Het
Ralbp1	T	A	17: 65,854,129	N473I	probably benign	Het
Rbp4	G	A	19: 38,118,460	T127M	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rps3a1	G	A	3: 86,138,117		probably benign	Het
Scg3	G	T	9: 75,643,940	Y429*	probably null	Het
Spag5	T	C	11: 78,313,396	S492P	probably damaging	Het
St7	T	A	6: 17,934,239	M540K	probably damaging	Het
Stxbp3	C	A	3: 108,805,302	V281F	possibly damaging	Het
Sun5	A	G	2: 153,859,048	V242A	possibly damaging	Het
Susd5	G	T	9: 114,095,784	R245L	possibly damaging	Het
Syne2	A	G	12: 75,923,013	E954G	probably damaging	Het
Synpo2	A	T	3: 123,114,059	V536E	probably damaging	Het
Tas2r140	T	C	6: 133,055,442	I118V	probably benign	Het
Tbx18	C	A	9: 87,724,409	V228L	probably benign	Het
Tdrd9	T	A	12: 112,007,580		probably benign	Het
Tg	T	C	15: 66,737,521	M310T	probably benign	Het
Ticam2	T	A	18: 46,560,651	D123V	probably damaging	Het
Timm23	A	G	14: 32,199,036		probably benign	Het
Tinag	C	T	9: 77,005,687	R280H	probably benign	Het
Topbp1	G	A	9: 103,308,812	R51K	probably benign	Het
Tor1b	A	G	2: 30,953,913	I121V	probably damaging	Het
Tpmt	C	A	13: 47,032,454	G148V	probably damaging	Het
Tubb1	A	G	2: 174,457,755	E410G	probably damaging	Het
Ubash3b	C	A	9: 41,047,064	V7L	possibly damaging	Het
Ube2o	C	T	11: 116,542,835	E686K	probably damaging	Het
Unc13d	T	A	11: 116,069,492		probably benign	Het
Vmn1r183	A	T	7: 24,055,176	M135L	probably benign	Het
Wisp3	T	C	10: 39,151,289	R316G	probably benign	Het
Xkr8	T	C	4: 132,732,338	Y43C	probably damaging	Het
Zc3h4	T	A	7: 16,434,772	N935K	unknown	Het
Zc3h7a	G	A	16: 11,156,303		probably benign	Het
Zfp84	C	T	7: 29,776,851	H323Y	probably damaging	Het
Zfp873	G	T	10: 82,060,761	S442I	possibly damaging	Het
Zfp938	A	G	10: 82,225,772	L338P	probably damaging	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9086:Cntnap3	UTSW	13	64781759	missense	probably damaging	1.00
R9087:Cntnap3	UTSW	13	64751718	missense	probably damaging	0.96
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
R9475:Cntnap3	UTSW	13	64799135	missense	probably damaging	1.00
R9625:Cntnap3	UTSW	13	64858765	missense	probably damaging	1.00
R9679:Cntnap3	UTSW	13	64751748	missense	probably damaging	1.00
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGATAACAGCACTCACCAATGAAGAGC -3'
(R):5'- TTTGCCCCTCCTCCAACTCAGAG -3'

Sequencing Primer
(F):5'- AGGAGTGGACTGTGTCTTCT -3'
(R):5'- CCAACTCAGAGTCAGATTTTTTTTTC -3'

Posted On

2014-08-21