Incidental Mutation 'R0666:Cntnap3'
ID218839
Institutional Source Beutler Lab
Gene Symbol Cntnap3
Ensembl Gene ENSMUSG00000033063
Gene Namecontactin associated protein-like 3
Synonyms
MMRRC Submission 038851-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0666 (G1)
Quality Score35
Status Validated
Chromosome13
Chromosomal Location64736182-64903955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 64757397 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 857 (D857N)
Ref Sequence ENSEMBL: ENSMUSP00000089140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091554]
Predicted Effect probably damaging
Transcript: ENSMUST00000091554
AA Change: D857N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: D857N

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FA58C 33 180 4.88e-17 SMART
LamG 207 345 1.47e-11 SMART
LamG 394 525 1.43e-23 SMART
EGF 553 587 1.33e-1 SMART
FBG 590 775 6.76e-1 SMART
LamG 815 942 1.89e-32 SMART
EGF_like 963 999 6.28e1 SMART
LamG 1040 1178 9.46e-15 SMART
transmembrane domain 1245 1267 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222618
Meta Mutation Damage Score 0.1531 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T G 11: 78,287,987 M2026R probably damaging Het
2610507B11Rik T A 11: 78,277,212 L1491* probably null Het
Akap6 T A 12: 52,911,808 V782E probably damaging Het
Atg9a A G 1: 75,185,090 L604P probably damaging Het
Atp1a3 T C 7: 24,990,549 I482V probably benign Het
Ccdc105 C A 10: 78,750,547 L223F probably benign Het
Ccdc18 T G 5: 108,163,664 V412G probably benign Het
Cct6a A G 5: 129,794,386 noncoding transcript Het
Clpx A G 9: 65,310,225 N25S probably damaging Het
Cnpy2 T A 10: 128,327,025 C171* probably null Het
Col5a1 A G 2: 28,032,685 Y255C probably damaging Het
Coro7 A T 16: 4,631,911 F638Y possibly damaging Het
Cpd A G 11: 76,782,327 F1331L probably damaging Het
Csmd1 A T 8: 16,069,049 I1842N possibly damaging Het
Dgkg T A 16: 22,562,730 D490V probably damaging Het
Dnah9 A T 11: 66,085,458 M1255K probably benign Het
E2f1 A G 2: 154,560,929 V306A probably benign Het
Entpd1 A G 19: 40,659,906 probably benign Het
Esrrb T A 12: 86,505,902 I222N probably benign Het
Fam159b G T 13: 104,858,354 T95K possibly damaging Het
Flt4 G T 11: 49,625,447 A126S possibly damaging Het
Galnt11 C T 5: 25,252,147 T237I possibly damaging Het
Gbf1 A G 19: 46,262,544 probably benign Het
Gm20388 A T 8: 122,270,988 probably benign Het
Gm7030 T C 17: 36,127,834 T222A possibly damaging Het
Herc1 T A 9: 66,484,888 probably benign Het
Hsph1 T C 5: 149,631,502 Y105C probably damaging Het
Il23r T C 6: 67,434,680 T358A probably benign Het
Il2ra C T 2: 11,643,073 probably benign Het
Kbtbd4 G T 2: 90,914,115 probably benign Het
Kcnt1 A G 2: 25,891,243 probably benign Het
Kng2 A G 16: 22,997,122 probably benign Het
Lap3 C T 5: 45,511,928 T473I possibly damaging Het
Lrrk2 T C 15: 91,757,070 probably null Het
Map1s A G 8: 70,914,052 N534D possibly damaging Het
Mtg1 G A 7: 140,144,344 V122I probably benign Het
Myadm T A 7: 3,297,349 I209K probably damaging Het
Ntsr2 G A 12: 16,653,980 V75I probably benign Het
Olfr1037 G A 2: 86,085,213 A188V probably benign Het
Olfr1272 A T 2: 90,281,868 S236T probably damaging Het
Pfn1 T C 11: 70,654,366 T39A probably benign Het
Pipox T A 11: 77,883,825 K144M probably benign Het
Plekhh1 G A 12: 79,069,115 E811K probably damaging Het
Pnpla3 T A 15: 84,179,305 W295R probably benign Het
Prkacb T A 3: 146,751,518 T136S probably damaging Het
Ralbp1 T A 17: 65,854,129 N473I probably benign Het
Rbp4 G A 19: 38,118,460 T127M probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rps3a1 G A 3: 86,138,117 probably benign Het
Scg3 G T 9: 75,643,940 Y429* probably null Het
Spag5 T C 11: 78,313,396 S492P probably damaging Het
St7 T A 6: 17,934,239 M540K probably damaging Het
Stxbp3 C A 3: 108,805,302 V281F possibly damaging Het
Sun5 A G 2: 153,859,048 V242A possibly damaging Het
Susd5 G T 9: 114,095,784 R245L possibly damaging Het
Syne2 A G 12: 75,923,013 E954G probably damaging Het
Synpo2 A T 3: 123,114,059 V536E probably damaging Het
Tas2r140 T C 6: 133,055,442 I118V probably benign Het
Tbx18 C A 9: 87,724,409 V228L probably benign Het
Tdrd9 T A 12: 112,007,580 probably benign Het
Tg T C 15: 66,737,521 M310T probably benign Het
Ticam2 T A 18: 46,560,651 D123V probably damaging Het
Timm23 A G 14: 32,199,036 probably benign Het
Tinag C T 9: 77,005,687 R280H probably benign Het
Topbp1 G A 9: 103,308,812 R51K probably benign Het
Tor1b A G 2: 30,953,913 I121V probably damaging Het
Tpmt C A 13: 47,032,454 G148V probably damaging Het
Tubb1 A G 2: 174,457,755 E410G probably damaging Het
Ubash3b C A 9: 41,047,064 V7L possibly damaging Het
Ube2o C T 11: 116,542,835 E686K probably damaging Het
Unc13d T A 11: 116,069,492 probably benign Het
Vmn1r183 A T 7: 24,055,176 M135L probably benign Het
Wisp3 T C 10: 39,151,289 R316G probably benign Het
Xkr8 T C 4: 132,732,338 Y43C probably damaging Het
Zc3h4 T A 7: 16,434,772 N935K unknown Het
Zc3h7a G A 16: 11,156,303 probably benign Het
Zfp84 C T 7: 29,776,851 H323Y probably damaging Het
Zfp873 G T 10: 82,060,761 S442I possibly damaging Het
Zfp938 A G 10: 82,225,772 L338P probably damaging Het
Other mutations in Cntnap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cntnap3 APN 13 64772731 missense probably damaging 1.00
IGL00782:Cntnap3 APN 13 64745805 splice site probably benign
IGL00976:Cntnap3 APN 13 64794352 missense probably damaging 1.00
IGL01319:Cntnap3 APN 13 64787837 missense probably damaging 1.00
IGL01610:Cntnap3 APN 13 64757301 missense probably damaging 0.98
IGL01861:Cntnap3 APN 13 64799108 missense probably damaging 1.00
IGL02127:Cntnap3 APN 13 64799064 splice site probably benign
IGL02133:Cntnap3 APN 13 64751673 splice site probably benign
IGL02251:Cntnap3 APN 13 64762036 missense probably damaging 1.00
IGL02272:Cntnap3 APN 13 64757411 missense probably damaging 1.00
IGL02370:Cntnap3 APN 13 64751751 missense probably benign
IGL02456:Cntnap3 APN 13 64799058 splice site probably benign
IGL02589:Cntnap3 APN 13 64792430 missense probably benign 0.08
IGL02695:Cntnap3 APN 13 64772132 missense probably benign 0.01
IGL02850:Cntnap3 APN 13 64757409 missense probably damaging 1.00
IGL03038:Cntnap3 APN 13 64741025 missense possibly damaging 0.50
IGL03188:Cntnap3 APN 13 64781745 missense probably damaging 0.97
IGL03327:Cntnap3 APN 13 64887768 nonsense probably null
PIT4480001:Cntnap3 UTSW 13 64757210 missense probably damaging 1.00
R0309:Cntnap3 UTSW 13 64757436 splice site probably benign
R0422:Cntnap3 UTSW 13 64757285 missense probably damaging 0.96
R0463:Cntnap3 UTSW 13 64778876 missense probably damaging 1.00
R0491:Cntnap3 UTSW 13 64762045 missense probably benign 0.01
R0499:Cntnap3 UTSW 13 64858678 missense probably benign 0.33
R0550:Cntnap3 UTSW 13 64762000 missense possibly damaging 0.86
R0613:Cntnap3 UTSW 13 64758414 missense probably damaging 1.00
R0840:Cntnap3 UTSW 13 64787910 missense possibly damaging 0.94
R1577:Cntnap3 UTSW 13 64758290 missense probably damaging 1.00
R1716:Cntnap3 UTSW 13 64762002 missense probably damaging 1.00
R1732:Cntnap3 UTSW 13 64740812 critical splice donor site probably null
R1739:Cntnap3 UTSW 13 64740592 missense probably benign 0.17
R1905:Cntnap3 UTSW 13 64903764 missense probably benign 0.04
R1988:Cntnap3 UTSW 13 64758390 missense probably damaging 1.00
R2086:Cntnap3 UTSW 13 64794262 missense possibly damaging 0.76
R3732:Cntnap3 UTSW 13 64740999 missense possibly damaging 0.73
R3808:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R3809:Cntnap3 UTSW 13 64781804 missense probably damaging 0.96
R4384:Cntnap3 UTSW 13 64748460 missense probably damaging 1.00
R4433:Cntnap3 UTSW 13 64778853 missense possibly damaging 0.92
R4631:Cntnap3 UTSW 13 64778883 missense probably benign 0.04
R4645:Cntnap3 UTSW 13 64778788 critical splice donor site probably null
R4702:Cntnap3 UTSW 13 64778862 missense probably benign 0.17
R4876:Cntnap3 UTSW 13 64787706 missense probably benign 0.00
R4994:Cntnap3 UTSW 13 64761984 missense possibly damaging 0.55
R5043:Cntnap3 UTSW 13 64794348 missense probably damaging 1.00
R5214:Cntnap3 UTSW 13 64762010 missense probably damaging 1.00
R5403:Cntnap3 UTSW 13 64761978 missense possibly damaging 0.90
R5571:Cntnap3 UTSW 13 64903758 missense probably damaging 0.98
R5587:Cntnap3 UTSW 13 64746738 missense probably damaging 1.00
R5695:Cntnap3 UTSW 13 64787955 missense probably damaging 0.99
R5834:Cntnap3 UTSW 13 64748577 missense probably benign 0.07
R5892:Cntnap3 UTSW 13 64799180 missense probably damaging 1.00
R5950:Cntnap3 UTSW 13 64787769 missense probably damaging 1.00
R6526:Cntnap3 UTSW 13 64781888 missense possibly damaging 0.96
R6954:Cntnap3 UTSW 13 64748559 missense probably benign 0.00
R7138:Cntnap3 UTSW 13 64781725 critical splice donor site probably null
R7355:Cntnap3 UTSW 13 64771962 missense probably benign
R7425:Cntnap3 UTSW 13 64758252 missense probably damaging 1.00
R7521:Cntnap3 UTSW 13 64772001 missense probably benign 0.22
R7719:Cntnap3 UTSW 13 64772777 nonsense probably null
R7810:Cntnap3 UTSW 13 64793308 missense possibly damaging 0.73
R7871:Cntnap3 UTSW 13 64903773 missense probably benign 0.00
R8259:Cntnap3 UTSW 13 64787867 missense probably damaging 0.99
R8415:Cntnap3 UTSW 13 64738665 missense probably benign 0.31
Z1176:Cntnap3 UTSW 13 64740872 frame shift probably null
Z1176:Cntnap3 UTSW 13 64792388 missense probably damaging 0.98
Z1177:Cntnap3 UTSW 13 64781892 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATAACAGCACTCACCAATGAAGAGC -3'
(R):5'- TTTGCCCCTCCTCCAACTCAGAG -3'

Sequencing Primer
(F):5'- AGGAGTGGACTGTGTCTTCT -3'
(R):5'- CCAACTCAGAGTCAGATTTTTTTTTC -3'
Posted On2014-08-21