Incidental Mutation 'R0669:Abcb11'
ID 218850
Institutional Source Beutler Lab
Gene Symbol Abcb11
Ensembl Gene ENSMUSG00000027048
Gene Name ATP-binding cassette, sub-family B (MDR/TAP), member 11
Synonyms PFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein
MMRRC Submission 038854-MU
Accession Numbers

Genbank: NM_021022; MGI: 1351619
Essential gene? Possibly essential (E-score: 0.602) question?
Stock # R0669 (G1)
Quality Score 68
Status Validated
Chromosome 2
Chromosomal Location 69238282-69342616 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 69329318 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 10 (V10L)
Ref Sequence ENSEMBL: ENSMUSP00000137017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]
AlphaFold Q9QY30
Predicted Effect probably benign
Transcript: ENSMUST00000102709
AA Change: V10L

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: V10L

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 373 1.3e-65 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1031 2.7e-55 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102710
AA Change: V10L

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: V10L

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.7e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 3.2e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117306
Predicted Effect probably benign
Transcript: ENSMUST00000180142
AA Change: V10L

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: V10L

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.4e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 2.5e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T A 11: 72,198,845 H71L possibly damaging Het
A230050P20Rik AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA 9: 20,873,717 probably benign Het
Abcb9 T C 5: 124,062,887 T689A probably damaging Het
Adam22 A G 5: 8,143,036 probably benign Het
Adamts5 A G 16: 85,899,726 I181T probably benign Het
Adamts9 A T 6: 92,880,957 V231D probably damaging Het
Angptl6 C T 9: 20,876,527 V197M probably damaging Het
Atp6v1c1 T C 15: 38,677,528 V99A probably benign Het
Cacna2d3 A G 14: 29,467,949 V110A probably benign Het
Ccdc32 A G 2: 119,019,167 probably benign Het
Cela3b T C 4: 137,428,530 H22R probably benign Het
Cep44 T C 8: 56,540,973 T190A possibly damaging Het
Chsy1 T C 7: 66,171,687 C557R probably damaging Het
Cntd1 A G 11: 101,287,498 T308A probably damaging Het
Cutal T C 2: 34,885,866 probably benign Het
Dgcr14 T C 16: 17,907,555 Y221C probably damaging Het
Dna2 A G 10: 62,956,989 D261G probably damaging Het
Dnhd1 T A 7: 105,693,704 S1418R probably benign Het
Dnpep A G 1: 75,311,778 probably benign Het
Dock7 A T 4: 98,987,479 Y1075N probably benign Het
Eif2s1 C T 12: 78,881,238 probably benign Het
Fam69b A G 2: 26,634,866 T93A probably benign Het
Fer1l6 T C 15: 58,553,724 probably null Het
Gm5592 T C 7: 41,155,830 probably benign Het
Ipp A G 4: 116,537,876 Y536C probably damaging Het
Krt72 T C 15: 101,778,305 E402G probably damaging Het
Lamb3 T C 1: 193,332,330 L599P probably damaging Het
Lingo2 T A 4: 35,709,120 T287S probably benign Het
Lipo3 T A 19: 33,559,625 T232S probably benign Het
Lrrc63 G A 14: 75,126,110 H194Y probably benign Het
Map3k13 A G 16: 21,906,524 T416A probably benign Het
Mcm3 A T 1: 20,804,929 probably null Het
Mms22l T C 4: 24,517,223 V258A probably benign Het
Mrpl46 A T 7: 78,782,883 L49* probably null Het
Mrs2 T C 13: 24,993,759 T369A possibly damaging Het
Mtrf1 T A 14: 79,419,268 Y403* probably null Het
Muc20 G A 16: 32,794,480 P176S unknown Het
Mup21 C T 4: 62,150,727 C9Y unknown Het
Mup-ps21 A T 4: 62,030,770 noncoding transcript Het
Mybph T G 1: 134,197,343 probably null Het
Mypn A G 10: 63,134,923 probably benign Het
Nav2 T C 7: 49,408,683 S124P probably damaging Het
Nrros T C 16: 32,143,423 D556G probably damaging Het
Numa1 A C 7: 101,999,677 I872L probably benign Het
Olfr1206 A T 2: 88,864,928 M108L probably benign Het
Olfr13 C T 6: 43,174,004 T6I probably benign Het
Olfr293 A G 7: 86,664,336 I225V possibly damaging Het
Olfr472 T A 7: 107,903,239 I174K probably damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pcdhb9 A T 18: 37,402,255 N434I probably damaging Het
Pigq A T 17: 25,936,762 probably null Het
Plxna2 T G 1: 194,788,837 V972G probably damaging Het
Psma3 G A 12: 70,988,495 probably benign Het
Ptpn13 A G 5: 103,556,109 T1336A probably benign Het
Rdh7 T C 10: 127,884,729 D258G probably benign Het
Serpinb6c A G 13: 33,899,269 I54T probably damaging Het
Sh2d7 A T 9: 54,541,349 Y218F probably benign Het
Slc12a8 A T 16: 33,550,904 I137F possibly damaging Het
Smarca2 T C 19: 26,706,200 V1153A possibly damaging Het
Smc6 A T 12: 11,289,164 I334L probably benign Het
Sorcs1 A G 19: 50,241,942 probably benign Het
Taar8c A G 10: 24,101,503 L137P probably damaging Het
Tcam1 A T 11: 106,285,426 D326V possibly damaging Het
Telo2 A T 17: 25,105,823 V461D probably benign Het
Tmprss7 A T 16: 45,677,962 C351* probably null Het
Trim66 T A 7: 109,454,992 probably benign Het
Ube2d1 G T 10: 71,262,110 H32N probably benign Het
Ubp1 T C 9: 113,964,668 probably benign Het
Vma21 C T X: 71,820,157 T81M probably damaging Het
Vmn1r113 T C 7: 20,787,420 S46P probably benign Het
Wars T C 12: 108,866,018 S374G probably benign Het
Wbp1 T C 6: 83,119,345 D277G possibly damaging Het
Zfp939 C A 7: 39,473,785 noncoding transcript Het
Other mutations in Abcb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Abcb11 APN 2 69284681 missense possibly damaging 0.90
IGL01407:Abcb11 APN 2 69245944 missense probably damaging 1.00
IGL01583:Abcb11 APN 2 69296409 missense possibly damaging 0.81
IGL01813:Abcb11 APN 2 69287592 splice site probably benign
IGL01885:Abcb11 APN 2 69287627 missense probably damaging 1.00
IGL01937:Abcb11 APN 2 69287612 missense probably damaging 1.00
IGL02058:Abcb11 APN 2 69243498 missense probably damaging 0.98
IGL02117:Abcb11 APN 2 69323825 splice site probably benign
IGL02119:Abcb11 APN 2 69328000 critical splice acceptor site probably null
IGL02120:Abcb11 APN 2 69257310 missense probably damaging 1.00
IGL02158:Abcb11 APN 2 69299925 missense probably damaging 0.96
IGL02212:Abcb11 APN 2 69248889 missense probably damaging 0.97
IGL02306:Abcb11 APN 2 69265457 nonsense probably null
IGL02505:Abcb11 APN 2 69245761 missense probably damaging 1.00
IGL02538:Abcb11 APN 2 69306605 missense possibly damaging 0.67
IGL02793:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL02863:Abcb11 APN 2 69284682 missense probably damaging 0.99
IGL02875:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL03164:Abcb11 APN 2 69291999 nonsense probably null
IGL03181:Abcb11 APN 2 69328008 intron probably benign
3-1:Abcb11 UTSW 2 69327993 missense probably benign 0.00
FR4737:Abcb11 UTSW 2 69243518 missense probably damaging 0.97
R0031:Abcb11 UTSW 2 69285308 missense probably damaging 1.00
R0398:Abcb11 UTSW 2 69286666 missense probably null 0.82
R0413:Abcb11 UTSW 2 69328011 intron probably benign
R0437:Abcb11 UTSW 2 69257295 missense probably damaging 1.00
R0496:Abcb11 UTSW 2 69277884 splice site probably benign
R0646:Abcb11 UTSW 2 69285283 missense probably damaging 1.00
R0856:Abcb11 UTSW 2 69323918 missense probably benign
R1061:Abcb11 UTSW 2 69277809 missense probably benign 0.00
R1460:Abcb11 UTSW 2 69257374 splice site probably benign
R1714:Abcb11 UTSW 2 69306581 missense probably damaging 0.99
R1739:Abcb11 UTSW 2 69261566 missense probably damaging 1.00
R1856:Abcb11 UTSW 2 69245923 missense probably damaging 1.00
R1994:Abcb11 UTSW 2 69282670 splice site probably null
R2086:Abcb11 UTSW 2 69259476 splice site probably benign
R2133:Abcb11 UTSW 2 69323883 missense possibly damaging 0.65
R2516:Abcb11 UTSW 2 69329329 missense possibly damaging 0.88
R2930:Abcb11 UTSW 2 69257358 missense probably damaging 0.96
R3771:Abcb11 UTSW 2 69329376 splice site probably benign
R3772:Abcb11 UTSW 2 69329376 splice site probably benign
R3979:Abcb11 UTSW 2 69323976 missense probably benign 0.11
R4227:Abcb11 UTSW 2 69284776 missense probably damaging 1.00
R4255:Abcb11 UTSW 2 69306605 missense probably benign 0.03
R4614:Abcb11 UTSW 2 69284681 missense possibly damaging 0.90
R4647:Abcb11 UTSW 2 69285271 missense probably damaging 1.00
R4719:Abcb11 UTSW 2 69259627 missense probably damaging 1.00
R4734:Abcb11 UTSW 2 69323962 missense possibly damaging 0.73
R4765:Abcb11 UTSW 2 69245867 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4870:Abcb11 UTSW 2 69239196 missense probably damaging 0.99
R4988:Abcb11 UTSW 2 69323892 missense probably benign 0.12
R5028:Abcb11 UTSW 2 69274012 missense probably damaging 1.00
R5048:Abcb11 UTSW 2 69308506 missense probably benign 0.06
R5177:Abcb11 UTSW 2 69285295 missense probably damaging 1.00
R5301:Abcb11 UTSW 2 69286847 missense probably damaging 0.98
R5789:Abcb11 UTSW 2 69245764 missense probably damaging 1.00
R5892:Abcb11 UTSW 2 69261500 missense probably damaging 0.99
R6003:Abcb11 UTSW 2 69243467 missense probably benign 0.43
R6252:Abcb11 UTSW 2 69291961 missense probably benign 0.10
R6389:Abcb11 UTSW 2 69323894 missense probably damaging 1.00
R6512:Abcb11 UTSW 2 69282652 missense probably benign
R6590:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6690:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6732:Abcb11 UTSW 2 69286846 missense probably damaging 1.00
R6870:Abcb11 UTSW 2 69285298 missense possibly damaging 0.91
R7028:Abcb11 UTSW 2 69265675 missense probably benign
R7223:Abcb11 UTSW 2 69274143 missense probably benign
R7323:Abcb11 UTSW 2 69287635 missense probably damaging 1.00
R7337:Abcb11 UTSW 2 69245769 missense probably damaging 1.00
R7339:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7340:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7341:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7343:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7366:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7393:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7394:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7405:Abcb11 UTSW 2 69287619 missense probably damaging 1.00
R7411:Abcb11 UTSW 2 69303936 critical splice donor site probably null
R7488:Abcb11 UTSW 2 69277802 missense probably benign
R7544:Abcb11 UTSW 2 69265486 missense probably benign 0.05
R7660:Abcb11 UTSW 2 69287594 splice site probably null
R7754:Abcb11 UTSW 2 69286818 missense probably damaging 1.00
R7771:Abcb11 UTSW 2 69239191 missense probably damaging 0.99
R7794:Abcb11 UTSW 2 69286678 missense possibly damaging 0.62
R7834:Abcb11 UTSW 2 69284724 missense probably damaging 1.00
R7897:Abcb11 UTSW 2 69323872 frame shift probably null
R7897:Abcb11 UTSW 2 69323873 small deletion probably benign
R7937:Abcb11 UTSW 2 69323873 small deletion probably benign
R8004:Abcb11 UTSW 2 69257210 missense possibly damaging 0.68
R8089:Abcb11 UTSW 2 69274039 missense probably benign 0.09
R8279:Abcb11 UTSW 2 69239205 missense probably benign 0.05
R8426:Abcb11 UTSW 2 69325262 missense probably benign
R8441:Abcb11 UTSW 2 69257230 missense possibly damaging 0.93
R8460:Abcb11 UTSW 2 69324037 missense possibly damaging 0.70
R8462:Abcb11 UTSW 2 69274155 missense probably benign
R8532:Abcb11 UTSW 2 69259691 missense possibly damaging 0.69
R8534:Abcb11 UTSW 2 69323846 missense possibly damaging 0.89
R8711:Abcb11 UTSW 2 69265512 missense probably damaging 1.00
R8746:Abcb11 UTSW 2 69257410 intron probably benign
R8964:Abcb11 UTSW 2 69286717 missense possibly damaging 0.52
R8990:Abcb11 UTSW 2 69274150 missense
R9081:Abcb11 UTSW 2 69292044 missense possibly damaging 0.59
R9093:Abcb11 UTSW 2 69239169 missense probably damaging 0.97
R9228:Abcb11 UTSW 2 69308465 nonsense probably null
R9294:Abcb11 UTSW 2 69265496 missense possibly damaging 0.89
X0058:Abcb11 UTSW 2 69289443 missense probably benign 0.12
X0062:Abcb11 UTSW 2 69245906 missense probably damaging 1.00
X0065:Abcb11 UTSW 2 69299866 missense probably damaging 0.99
Z1176:Abcb11 UTSW 2 69291981 missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69306529 missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69329269 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGTGTCAAGGCCCCTCATTTCTG -3'
(R):5'- AGCTTGTTTCTTGAGCCAAGTCCC -3'

Sequencing Primer
(F):5'- CACTCTACTGAGAAGGAAGTGCTC -3'
(R):5'- GAGCCAAGTCCCTTGCTTATTTAG -3'
Posted On 2014-08-21