Incidental Mutation 'R0669:Abcb11'
ID 218850
Institutional Source Beutler Lab
Gene Symbol Abcb11
Ensembl Gene ENSMUSG00000027048
Gene Name ATP-binding cassette, sub-family B member 11
Synonyms sister of P-glycoprotein, ABC16, PFIC2, Bsep, PGY4, Lith1
MMRRC Submission 038854-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.732) question?
Stock # R0669 (G1)
Quality Score 68
Status Validated
Chromosome 2
Chromosomal Location 69068626-69172960 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 69159662 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 10 (V10L)
Ref Sequence ENSEMBL: ENSMUSP00000137017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]
AlphaFold Q9QY30
Predicted Effect probably benign
Transcript: ENSMUST00000102709
AA Change: V10L

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: V10L

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 373 1.3e-65 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1031 2.7e-55 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102710
AA Change: V10L

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: V10L

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.7e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 3.2e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117306
Predicted Effect probably benign
Transcript: ENSMUST00000180142
AA Change: V10L

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: V10L

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.4e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 2.5e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T A 11: 72,089,671 (GRCm39) H71L possibly damaging Het
Abcb9 T C 5: 124,200,950 (GRCm39) T689A probably damaging Het
Adam22 A G 5: 8,193,036 (GRCm39) probably benign Het
Adamts5 A G 16: 85,696,614 (GRCm39) I181T probably benign Het
Adamts9 A T 6: 92,857,938 (GRCm39) V231D probably damaging Het
Angptl6 C T 9: 20,787,823 (GRCm39) V197M probably damaging Het
Atp6v1c1 T C 15: 38,677,772 (GRCm39) V99A probably benign Het
Cacna2d3 A G 14: 29,189,906 (GRCm39) V110A probably benign Het
Ccdc32 A G 2: 118,849,648 (GRCm39) probably benign Het
Cela3b T C 4: 137,155,841 (GRCm39) H22R probably benign Het
Cep44 T C 8: 56,994,008 (GRCm39) T190A possibly damaging Het
Chsy1 T C 7: 65,821,435 (GRCm39) C557R probably damaging Het
Cntd1 A G 11: 101,178,324 (GRCm39) T308A probably damaging Het
Cutal T C 2: 34,775,878 (GRCm39) probably benign Het
Dipk1b A G 2: 26,524,878 (GRCm39) T93A probably benign Het
Dna2 A G 10: 62,792,768 (GRCm39) D261G probably damaging Het
Dnhd1 T A 7: 105,342,911 (GRCm39) S1418R probably benign Het
Dnpep A G 1: 75,288,422 (GRCm39) probably benign Het
Dock7 A T 4: 98,875,716 (GRCm39) Y1075N probably benign Het
Eif2s1 C T 12: 78,928,012 (GRCm39) probably benign Het
Ess2 T C 16: 17,725,419 (GRCm39) Y221C probably damaging Het
Fer1l6 T C 15: 58,425,573 (GRCm39) probably null Het
Gm5592 T C 7: 40,805,254 (GRCm39) probably benign Het
Ipp A G 4: 116,395,073 (GRCm39) Y536C probably damaging Het
Krt72 T C 15: 101,686,740 (GRCm39) E402G probably damaging Het
Lamb3 T C 1: 193,014,638 (GRCm39) L599P probably damaging Het
Lingo2 T A 4: 35,709,120 (GRCm39) T287S probably benign Het
Lipo3 T A 19: 33,537,025 (GRCm39) T232S probably benign Het
Lrrc63 G A 14: 75,363,550 (GRCm39) H194Y probably benign Het
Map3k13 A G 16: 21,725,274 (GRCm39) T416A probably benign Het
Mcm3 A T 1: 20,875,153 (GRCm39) probably null Het
Mms22l T C 4: 24,517,223 (GRCm39) V258A probably benign Het
Mrpl46 A T 7: 78,432,631 (GRCm39) L49* probably null Het
Mrs2 T C 13: 25,177,742 (GRCm39) T369A possibly damaging Het
Mtrf1 T A 14: 79,656,708 (GRCm39) Y403* probably null Het
Muc20 G A 16: 32,614,850 (GRCm39) P176S unknown Het
Mup21 C T 4: 62,068,964 (GRCm39) C9Y unknown Het
Mup-ps21 A T 4: 61,949,007 (GRCm39) noncoding transcript Het
Mybph T G 1: 134,125,081 (GRCm39) probably null Het
Mypn A G 10: 62,970,702 (GRCm39) probably benign Het
Nav2 T C 7: 49,058,431 (GRCm39) S124P probably damaging Het
Nrros T C 16: 31,962,241 (GRCm39) D556G probably damaging Het
Numa1 A C 7: 101,648,884 (GRCm39) I872L probably benign Het
Or14c40 A G 7: 86,313,544 (GRCm39) I225V possibly damaging Het
Or2a7 C T 6: 43,150,938 (GRCm39) T6I probably benign Het
Or2h2c G C 17: 37,422,347 (GRCm39) L176V probably benign Het
Or4c11 A T 2: 88,695,272 (GRCm39) M108L probably benign Het
Or5p52 T A 7: 107,502,446 (GRCm39) I174K probably damaging Het
Pcdhb9 A T 18: 37,535,308 (GRCm39) N434I probably damaging Het
Pigq A T 17: 26,155,736 (GRCm39) probably null Het
Plxna2 T G 1: 194,471,145 (GRCm39) V972G probably damaging Het
Psma3 G A 12: 71,035,269 (GRCm39) probably benign Het
Ptpn13 A G 5: 103,703,975 (GRCm39) T1336A probably benign Het
Rdh7 T C 10: 127,720,598 (GRCm39) D258G probably benign Het
Serpinb6c A G 13: 34,083,252 (GRCm39) I54T probably damaging Het
Sh2d7 A T 9: 54,448,633 (GRCm39) Y218F probably benign Het
Shfl AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA 9: 20,785,013 (GRCm39) probably benign Het
Slc12a8 A T 16: 33,371,274 (GRCm39) I137F possibly damaging Het
Smarca2 T C 19: 26,683,600 (GRCm39) V1153A possibly damaging Het
Smc6 A T 12: 11,339,165 (GRCm39) I334L probably benign Het
Sorcs1 A G 19: 50,230,380 (GRCm39) probably benign Het
Taar8c A G 10: 23,977,401 (GRCm39) L137P probably damaging Het
Tcam1 A T 11: 106,176,252 (GRCm39) D326V possibly damaging Het
Telo2 A T 17: 25,324,797 (GRCm39) V461D probably benign Het
Tmprss7 A T 16: 45,498,325 (GRCm39) C351* probably null Het
Trim66 T A 7: 109,054,199 (GRCm39) probably benign Het
Ube2d1 G T 10: 71,097,940 (GRCm39) H32N probably benign Het
Ubp1 T C 9: 113,793,736 (GRCm39) probably benign Het
Vma21 C T X: 70,863,763 (GRCm39) T81M probably damaging Het
Vmn1r113 T C 7: 20,521,345 (GRCm39) S46P probably benign Het
Wars1 T C 12: 108,831,944 (GRCm39) S374G probably benign Het
Wbp1 T C 6: 83,096,326 (GRCm39) D277G possibly damaging Het
Zfp939 C A 7: 39,123,209 (GRCm39) noncoding transcript Het
Other mutations in Abcb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Abcb11 APN 2 69,115,025 (GRCm39) missense possibly damaging 0.90
IGL01407:Abcb11 APN 2 69,076,288 (GRCm39) missense probably damaging 1.00
IGL01583:Abcb11 APN 2 69,126,753 (GRCm39) missense possibly damaging 0.81
IGL01813:Abcb11 APN 2 69,117,936 (GRCm39) splice site probably benign
IGL01885:Abcb11 APN 2 69,117,971 (GRCm39) missense probably damaging 1.00
IGL01937:Abcb11 APN 2 69,117,956 (GRCm39) missense probably damaging 1.00
IGL02058:Abcb11 APN 2 69,073,842 (GRCm39) missense probably damaging 0.98
IGL02117:Abcb11 APN 2 69,154,169 (GRCm39) splice site probably benign
IGL02119:Abcb11 APN 2 69,158,344 (GRCm39) critical splice acceptor site probably null
IGL02120:Abcb11 APN 2 69,087,654 (GRCm39) missense probably damaging 1.00
IGL02158:Abcb11 APN 2 69,130,269 (GRCm39) missense probably damaging 0.96
IGL02212:Abcb11 APN 2 69,079,233 (GRCm39) missense probably damaging 0.97
IGL02306:Abcb11 APN 2 69,095,801 (GRCm39) nonsense probably null
IGL02505:Abcb11 APN 2 69,076,105 (GRCm39) missense probably damaging 1.00
IGL02538:Abcb11 APN 2 69,136,949 (GRCm39) missense possibly damaging 0.67
IGL02793:Abcb11 APN 2 69,122,293 (GRCm39) missense possibly damaging 0.90
IGL02863:Abcb11 APN 2 69,115,026 (GRCm39) missense probably damaging 0.99
IGL02875:Abcb11 APN 2 69,122,293 (GRCm39) missense possibly damaging 0.90
IGL03164:Abcb11 APN 2 69,122,343 (GRCm39) nonsense probably null
IGL03181:Abcb11 APN 2 69,158,352 (GRCm39) intron probably benign
3-1:Abcb11 UTSW 2 69,158,337 (GRCm39) missense probably benign 0.00
FR4737:Abcb11 UTSW 2 69,073,862 (GRCm39) missense probably damaging 0.97
R0031:Abcb11 UTSW 2 69,115,652 (GRCm39) missense probably damaging 1.00
R0398:Abcb11 UTSW 2 69,117,010 (GRCm39) missense probably null 0.82
R0413:Abcb11 UTSW 2 69,158,355 (GRCm39) intron probably benign
R0437:Abcb11 UTSW 2 69,087,639 (GRCm39) missense probably damaging 1.00
R0496:Abcb11 UTSW 2 69,108,228 (GRCm39) splice site probably benign
R0646:Abcb11 UTSW 2 69,115,627 (GRCm39) missense probably damaging 1.00
R0856:Abcb11 UTSW 2 69,154,262 (GRCm39) missense probably benign
R1061:Abcb11 UTSW 2 69,108,153 (GRCm39) missense probably benign 0.00
R1460:Abcb11 UTSW 2 69,087,718 (GRCm39) splice site probably benign
R1714:Abcb11 UTSW 2 69,136,925 (GRCm39) missense probably damaging 0.99
R1739:Abcb11 UTSW 2 69,091,910 (GRCm39) missense probably damaging 1.00
R1856:Abcb11 UTSW 2 69,076,267 (GRCm39) missense probably damaging 1.00
R1994:Abcb11 UTSW 2 69,113,014 (GRCm39) splice site probably null
R2086:Abcb11 UTSW 2 69,089,820 (GRCm39) splice site probably benign
R2133:Abcb11 UTSW 2 69,154,227 (GRCm39) missense possibly damaging 0.65
R2516:Abcb11 UTSW 2 69,159,673 (GRCm39) missense possibly damaging 0.88
R2930:Abcb11 UTSW 2 69,087,702 (GRCm39) missense probably damaging 0.96
R3771:Abcb11 UTSW 2 69,159,720 (GRCm39) splice site probably benign
R3772:Abcb11 UTSW 2 69,159,720 (GRCm39) splice site probably benign
R3979:Abcb11 UTSW 2 69,154,320 (GRCm39) missense probably benign 0.11
R4227:Abcb11 UTSW 2 69,115,120 (GRCm39) missense probably damaging 1.00
R4255:Abcb11 UTSW 2 69,136,949 (GRCm39) missense probably benign 0.03
R4614:Abcb11 UTSW 2 69,115,025 (GRCm39) missense possibly damaging 0.90
R4647:Abcb11 UTSW 2 69,115,615 (GRCm39) missense probably damaging 1.00
R4719:Abcb11 UTSW 2 69,089,971 (GRCm39) missense probably damaging 1.00
R4734:Abcb11 UTSW 2 69,154,306 (GRCm39) missense possibly damaging 0.73
R4765:Abcb11 UTSW 2 69,076,211 (GRCm39) missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69,076,249 (GRCm39) missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69,076,249 (GRCm39) missense probably damaging 1.00
R4870:Abcb11 UTSW 2 69,069,540 (GRCm39) missense probably damaging 0.99
R4988:Abcb11 UTSW 2 69,154,236 (GRCm39) missense probably benign 0.12
R5028:Abcb11 UTSW 2 69,104,356 (GRCm39) missense probably damaging 1.00
R5048:Abcb11 UTSW 2 69,138,850 (GRCm39) missense probably benign 0.06
R5177:Abcb11 UTSW 2 69,115,639 (GRCm39) missense probably damaging 1.00
R5301:Abcb11 UTSW 2 69,117,191 (GRCm39) missense probably damaging 0.98
R5789:Abcb11 UTSW 2 69,076,108 (GRCm39) missense probably damaging 1.00
R5892:Abcb11 UTSW 2 69,091,844 (GRCm39) missense probably damaging 0.99
R6003:Abcb11 UTSW 2 69,073,811 (GRCm39) missense probably benign 0.43
R6252:Abcb11 UTSW 2 69,122,305 (GRCm39) missense probably benign 0.10
R6389:Abcb11 UTSW 2 69,154,238 (GRCm39) missense probably damaging 1.00
R6512:Abcb11 UTSW 2 69,112,996 (GRCm39) missense probably benign
R6590:Abcb11 UTSW 2 69,115,062 (GRCm39) missense probably damaging 1.00
R6690:Abcb11 UTSW 2 69,115,062 (GRCm39) missense probably damaging 1.00
R6732:Abcb11 UTSW 2 69,117,190 (GRCm39) missense probably damaging 1.00
R6870:Abcb11 UTSW 2 69,115,642 (GRCm39) missense possibly damaging 0.91
R7028:Abcb11 UTSW 2 69,096,019 (GRCm39) missense probably benign
R7223:Abcb11 UTSW 2 69,104,487 (GRCm39) missense probably benign
R7323:Abcb11 UTSW 2 69,117,979 (GRCm39) missense probably damaging 1.00
R7337:Abcb11 UTSW 2 69,076,113 (GRCm39) missense probably damaging 1.00
R7339:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7340:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7341:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7343:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7366:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7393:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7394:Abcb11 UTSW 2 69,130,211 (GRCm39) missense probably damaging 0.99
R7405:Abcb11 UTSW 2 69,117,963 (GRCm39) missense probably damaging 1.00
R7411:Abcb11 UTSW 2 69,134,280 (GRCm39) critical splice donor site probably null
R7488:Abcb11 UTSW 2 69,108,146 (GRCm39) missense probably benign
R7544:Abcb11 UTSW 2 69,095,830 (GRCm39) missense probably benign 0.05
R7660:Abcb11 UTSW 2 69,117,938 (GRCm39) splice site probably null
R7754:Abcb11 UTSW 2 69,117,162 (GRCm39) missense probably damaging 1.00
R7771:Abcb11 UTSW 2 69,069,535 (GRCm39) missense probably damaging 0.99
R7794:Abcb11 UTSW 2 69,117,022 (GRCm39) missense possibly damaging 0.62
R7834:Abcb11 UTSW 2 69,115,068 (GRCm39) missense probably damaging 1.00
R7897:Abcb11 UTSW 2 69,154,217 (GRCm39) small deletion probably benign
R7897:Abcb11 UTSW 2 69,154,216 (GRCm39) frame shift probably null
R7937:Abcb11 UTSW 2 69,154,217 (GRCm39) small deletion probably benign
R8004:Abcb11 UTSW 2 69,087,554 (GRCm39) missense possibly damaging 0.68
R8089:Abcb11 UTSW 2 69,104,383 (GRCm39) missense probably benign 0.09
R8279:Abcb11 UTSW 2 69,069,549 (GRCm39) missense probably benign 0.05
R8426:Abcb11 UTSW 2 69,155,606 (GRCm39) missense probably benign
R8441:Abcb11 UTSW 2 69,087,574 (GRCm39) missense possibly damaging 0.93
R8460:Abcb11 UTSW 2 69,154,381 (GRCm39) missense possibly damaging 0.70
R8462:Abcb11 UTSW 2 69,104,499 (GRCm39) missense probably benign
R8532:Abcb11 UTSW 2 69,090,035 (GRCm39) missense possibly damaging 0.69
R8534:Abcb11 UTSW 2 69,154,190 (GRCm39) missense possibly damaging 0.89
R8711:Abcb11 UTSW 2 69,095,856 (GRCm39) missense probably damaging 1.00
R8746:Abcb11 UTSW 2 69,087,754 (GRCm39) intron probably benign
R8964:Abcb11 UTSW 2 69,117,061 (GRCm39) missense possibly damaging 0.52
R8990:Abcb11 UTSW 2 69,104,494 (GRCm39) missense
R9081:Abcb11 UTSW 2 69,122,388 (GRCm39) missense possibly damaging 0.59
R9093:Abcb11 UTSW 2 69,069,513 (GRCm39) missense probably damaging 0.97
R9228:Abcb11 UTSW 2 69,138,809 (GRCm39) nonsense probably null
R9294:Abcb11 UTSW 2 69,095,840 (GRCm39) missense possibly damaging 0.89
X0058:Abcb11 UTSW 2 69,119,787 (GRCm39) missense probably benign 0.12
X0062:Abcb11 UTSW 2 69,076,250 (GRCm39) missense probably damaging 1.00
X0065:Abcb11 UTSW 2 69,130,210 (GRCm39) missense probably damaging 0.99
Z1176:Abcb11 UTSW 2 69,122,325 (GRCm39) missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69,159,613 (GRCm39) critical splice donor site probably null
Z1177:Abcb11 UTSW 2 69,136,873 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGTCAAGGCCCCTCATTTCTG -3'
(R):5'- AGCTTGTTTCTTGAGCCAAGTCCC -3'

Sequencing Primer
(F):5'- CACTCTACTGAGAAGGAAGTGCTC -3'
(R):5'- GAGCCAAGTCCCTTGCTTATTTAG -3'
Posted On 2014-08-21