Incidental Mutation 'R0669:Muc20'
ID218864
Institutional Source Beutler Lab
Gene Symbol Muc20
Ensembl Gene ENSMUSG00000035638
Gene Namemucin 20
Synonyms
MMRRC Submission 038854-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R0669 (G1)
Quality Score42
Status Validated
Chromosome16
Chromosomal Location32777419-32797435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32794480 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 176 (P176S)
Ref Sequence ENSEMBL: ENSMUSP00000110769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041123] [ENSMUST00000115116]
Predicted Effect unknown
Transcript: ENSMUST00000041123
AA Change: P176S
SMART Domains Protein: ENSMUSP00000041221
Gene: ENSMUSG00000035638
AA Change: P176S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
internal_repeat_1 114 146 3.3e-8 PROSPERO
internal_repeat_1 138 170 3.3e-8 PROSPERO
internal_repeat_2 144 161 5.26e-5 PROSPERO
low complexity region 171 204 N/A INTRINSIC
low complexity region 210 227 N/A INTRINSIC
internal_repeat_2 228 245 5.26e-5 PROSPERO
low complexity region 324 351 N/A INTRINSIC
low complexity region 376 385 N/A INTRINSIC
low complexity region 516 550 N/A INTRINSIC
low complexity region 574 593 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000115116
AA Change: P176S
SMART Domains Protein: ENSMUSP00000110769
Gene: ENSMUSG00000035638
AA Change: P176S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
internal_repeat_1 114 146 2.16e-8 PROSPERO
internal_repeat_1 138 170 2.16e-8 PROSPERO
internal_repeat_2 144 161 4e-5 PROSPERO
low complexity region 171 204 N/A INTRINSIC
low complexity region 210 227 N/A INTRINSIC
internal_repeat_2 228 245 4e-5 PROSPERO
low complexity region 324 351 N/A INTRINSIC
low complexity region 376 385 N/A INTRINSIC
low complexity region 516 550 N/A INTRINSIC
low complexity region 574 593 N/A INTRINSIC
low complexity region 662 679 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins secreted by many epithelial tissues to form an insoluble mucous barrier. The C-terminus of this family member associates with the multifunctional docking site of the MET proto-oncogene and suppresses activation of some downstream MET signaling cascades. The protein features a mucin tandem repeat domain that varies between two and six copies in most individuals. Multiple variants encoding different isoforms have been found for this gene. A related pseudogene, which is also located on chromosome 3, has been identified. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T A 11: 72,198,845 H71L possibly damaging Het
A230050P20Rik AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA 9: 20,873,717 probably benign Het
Abcb11 C A 2: 69,329,318 V10L probably benign Het
Abcb9 T C 5: 124,062,887 T689A probably damaging Het
Adam22 A G 5: 8,143,036 probably benign Het
Adamts5 A G 16: 85,899,726 I181T probably benign Het
Adamts9 A T 6: 92,880,957 V231D probably damaging Het
Angptl6 C T 9: 20,876,527 V197M probably damaging Het
Atp6v1c1 T C 15: 38,677,528 V99A probably benign Het
Cacna2d3 A G 14: 29,467,949 V110A probably benign Het
Ccdc32 A G 2: 119,019,167 probably benign Het
Cela3b T C 4: 137,428,530 H22R probably benign Het
Cep44 T C 8: 56,540,973 T190A possibly damaging Het
Chsy1 T C 7: 66,171,687 C557R probably damaging Het
Cntd1 A G 11: 101,287,498 T308A probably damaging Het
Cutal T C 2: 34,885,866 probably benign Het
Dgcr14 T C 16: 17,907,555 Y221C probably damaging Het
Dna2 A G 10: 62,956,989 D261G probably damaging Het
Dnhd1 T A 7: 105,693,704 S1418R probably benign Het
Dnpep A G 1: 75,311,778 probably benign Het
Dock7 A T 4: 98,987,479 Y1075N probably benign Het
Eif2s1 C T 12: 78,881,238 probably benign Het
Fam69b A G 2: 26,634,866 T93A probably benign Het
Fer1l6 T C 15: 58,553,724 probably null Het
Gm5592 T C 7: 41,155,830 probably benign Het
Ipp A G 4: 116,537,876 Y536C probably damaging Het
Krt72 T C 15: 101,778,305 E402G probably damaging Het
Lamb3 T C 1: 193,332,330 L599P probably damaging Het
Lingo2 T A 4: 35,709,120 T287S probably benign Het
Lipo3 T A 19: 33,559,625 T232S probably benign Het
Lrrc63 G A 14: 75,126,110 H194Y probably benign Het
Map3k13 A G 16: 21,906,524 T416A probably benign Het
Mcm3 A T 1: 20,804,929 probably null Het
Mms22l T C 4: 24,517,223 V258A probably benign Het
Mrpl46 A T 7: 78,782,883 L49* probably null Het
Mrs2 T C 13: 24,993,759 T369A possibly damaging Het
Mtrf1 T A 14: 79,419,268 Y403* probably null Het
Mup21 C T 4: 62,150,727 C9Y unknown Het
Mup-ps21 A T 4: 62,030,770 noncoding transcript Het
Mybph T G 1: 134,197,343 probably null Het
Mypn A G 10: 63,134,923 probably benign Het
Nav2 T C 7: 49,408,683 S124P probably damaging Het
Nrros T C 16: 32,143,423 D556G probably damaging Het
Numa1 A C 7: 101,999,677 I872L probably benign Het
Olfr1206 A T 2: 88,864,928 M108L probably benign Het
Olfr13 C T 6: 43,174,004 T6I probably benign Het
Olfr293 A G 7: 86,664,336 I225V possibly damaging Het
Olfr472 T A 7: 107,903,239 I174K probably damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pcdhb9 A T 18: 37,402,255 N434I probably damaging Het
Pigq A T 17: 25,936,762 probably null Het
Plxna2 T G 1: 194,788,837 V972G probably damaging Het
Psma3 G A 12: 70,988,495 probably benign Het
Ptpn13 A G 5: 103,556,109 T1336A probably benign Het
Rdh7 T C 10: 127,884,729 D258G probably benign Het
Serpinb6c A G 13: 33,899,269 I54T probably damaging Het
Sh2d7 A T 9: 54,541,349 Y218F probably benign Het
Slc12a8 A T 16: 33,550,904 I137F possibly damaging Het
Smarca2 T C 19: 26,706,200 V1153A possibly damaging Het
Smc6 A T 12: 11,289,164 I334L probably benign Het
Sorcs1 A G 19: 50,241,942 probably benign Het
Taar8c A G 10: 24,101,503 L137P probably damaging Het
Tcam1 A T 11: 106,285,426 D326V possibly damaging Het
Telo2 A T 17: 25,105,823 V461D probably benign Het
Tmprss7 A T 16: 45,677,962 C351* probably null Het
Trim66 T A 7: 109,454,992 probably benign Het
Ube2d1 G T 10: 71,262,110 H32N probably benign Het
Ubp1 T C 9: 113,964,668 probably benign Het
Vma21 C T X: 71,820,157 T81M probably damaging Het
Vmn1r113 T C 7: 20,787,420 S46P probably benign Het
Wars T C 12: 108,866,018 S374G probably benign Het
Wbp1 T C 6: 83,119,345 D277G possibly damaging Het
Zfp939 C A 7: 39,473,785 noncoding transcript Het
Other mutations in Muc20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01953:Muc20 APN 16 32793703 missense probably benign 0.10
IGL02016:Muc20 APN 16 32797352 missense possibly damaging 0.46
IGL02092:Muc20 APN 16 32794272 missense probably damaging 0.99
IGL02415:Muc20 APN 16 32794681 missense unknown
R6669_muc20_072 UTSW 16 32793937 missense possibly damaging 0.94
R0552:Muc20 UTSW 16 32793930 missense probably damaging 0.98
R0629:Muc20 UTSW 16 32793421 missense possibly damaging 0.66
R0725:Muc20 UTSW 16 32793488 missense probably benign 0.05
R1676:Muc20 UTSW 16 32794279 missense probably damaging 1.00
R1771:Muc20 UTSW 16 32793852 missense probably damaging 0.97
R1778:Muc20 UTSW 16 32794141 missense possibly damaging 0.49
R1967:Muc20 UTSW 16 32794242 missense probably benign 0.03
R2104:Muc20 UTSW 16 32794177 missense probably damaging 0.99
R3054:Muc20 UTSW 16 32779029 missense probably benign 0.18
R4704:Muc20 UTSW 16 32779074 missense possibly damaging 0.70
R4893:Muc20 UTSW 16 32794672 missense possibly damaging 0.66
R4986:Muc20 UTSW 16 32777635 intron probably benign
R5191:Muc20 UTSW 16 32794476 missense unknown
R5195:Muc20 UTSW 16 32794476 missense unknown
R5875:Muc20 UTSW 16 32793819 missense possibly damaging 0.93
R5931:Muc20 UTSW 16 32794574 missense possibly damaging 0.81
R6434:Muc20 UTSW 16 32794806 missense probably benign 0.01
R6523:Muc20 UTSW 16 32793450 missense possibly damaging 0.90
R6580:Muc20 UTSW 16 32793489 missense possibly damaging 0.77
R6669:Muc20 UTSW 16 32793937 missense possibly damaging 0.94
R7028:Muc20 UTSW 16 32794246 missense probably benign 0.03
R7681:Muc20 UTSW 16 32793619 missense probably benign 0.34
R7722:Muc20 UTSW 16 32797386 missense probably benign 0.00
W0251:Muc20 UTSW 16 32793853 missense possibly damaging 0.91
X0011:Muc20 UTSW 16 32793252 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TTGAAACCGTTCTGGTCTCCGTTAC -3'
(R):5'- CGCAAACTCTCAGCACTGAATCTGC -3'

Sequencing Primer
(F):5'- GTCAATTCAATAGGTGAGATGGTC -3'
(R):5'- TCAGTTCAGAGGTCAATTCCAGAG -3'
Posted On2014-08-21