Mutagenetix > Incidental Mutations

Incidental Mutation 'R0669:Muc20'

218864

Institutional Source

Beutler Lab

Gene Symbol

Muc20

Ensembl Gene

ENSMUSG00000035638

Gene Name

mucin 20

Synonyms

MMRRC Submission

038854-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R0669 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

32777419-32797435 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 32794480 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 176 (P176S)

Ref Sequence

ENSEMBL: ENSMUSP00000110769 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041123] [ENSMUST00000115116]

Predicted Effect

unknown
Transcript: ENSMUST00000041123
AA Change: P176S

SMART Domains

Protein: ENSMUSP00000041221
Gene: ENSMUSG00000035638
AA Change: P176S

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	97	113	N/A	INTRINSIC
internal_repeat_1	114	146	3.3e-8	PROSPERO
internal_repeat_1	138	170	3.3e-8	PROSPERO
internal_repeat_2	144	161	5.26e-5	PROSPERO
low complexity region	171	204	N/A	INTRINSIC
low complexity region	210	227	N/A	INTRINSIC
internal_repeat_2	228	245	5.26e-5	PROSPERO
low complexity region	324	351	N/A	INTRINSIC
low complexity region	376	385	N/A	INTRINSIC
low complexity region	516	550	N/A	INTRINSIC
low complexity region	574	593	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000115116
AA Change: P176S

SMART Domains

Protein: ENSMUSP00000110769
Gene: ENSMUSG00000035638
AA Change: P176S

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	97	113	N/A	INTRINSIC
internal_repeat_1	114	146	2.16e-8	PROSPERO
internal_repeat_1	138	170	2.16e-8	PROSPERO
internal_repeat_2	144	161	4e-5	PROSPERO
low complexity region	171	204	N/A	INTRINSIC
low complexity region	210	227	N/A	INTRINSIC
internal_repeat_2	228	245	4e-5	PROSPERO
low complexity region	324	351	N/A	INTRINSIC
low complexity region	376	385	N/A	INTRINSIC
low complexity region	516	550	N/A	INTRINSIC
low complexity region	574	593	N/A	INTRINSIC
low complexity region	662	679	N/A	INTRINSIC

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 95.8%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins secreted by many epithelial tissues to form an insoluble mucous barrier. The C-terminus of this family member associates with the multifunctional docking site of the MET proto-oncogene and suppresses activation of some downstream MET signaling cascades. The protein features a mucin tandem repeat domain that varies between two and six copies in most individuals. Multiple variants encoding different isoforms have been found for this gene. A related pseudogene, which is also located on chromosome 3, has been identified. [provided by RefSeq, Apr 2014]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427D14Rik	T	A	11: 72,198,845	H71L	possibly damaging	Het
A230050P20Rik	AGAGGAGGAGGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGAGGAGGAGGA	9: 20,873,717		probably benign	Het
Abcb11	C	A	2: 69,329,318	V10L	probably benign	Het
Abcb9	T	C	5: 124,062,887	T689A	probably damaging	Het
Adam22	A	G	5: 8,143,036		probably benign	Het
Adamts5	A	G	16: 85,899,726	I181T	probably benign	Het
Adamts9	A	T	6: 92,880,957	V231D	probably damaging	Het
Angptl6	C	T	9: 20,876,527	V197M	probably damaging	Het
Atp6v1c1	T	C	15: 38,677,528	V99A	probably benign	Het
Cacna2d3	A	G	14: 29,467,949	V110A	probably benign	Het
Ccdc32	A	G	2: 119,019,167		probably benign	Het
Cela3b	T	C	4: 137,428,530	H22R	probably benign	Het
Cep44	T	C	8: 56,540,973	T190A	possibly damaging	Het
Chsy1	T	C	7: 66,171,687	C557R	probably damaging	Het
Cntd1	A	G	11: 101,287,498	T308A	probably damaging	Het
Cutal	T	C	2: 34,885,866		probably benign	Het
Dgcr14	T	C	16: 17,907,555	Y221C	probably damaging	Het
Dna2	A	G	10: 62,956,989	D261G	probably damaging	Het
Dnhd1	T	A	7: 105,693,704	S1418R	probably benign	Het
Dnpep	A	G	1: 75,311,778		probably benign	Het
Dock7	A	T	4: 98,987,479	Y1075N	probably benign	Het
Eif2s1	C	T	12: 78,881,238		probably benign	Het
Fam69b	A	G	2: 26,634,866	T93A	probably benign	Het
Fer1l6	T	C	15: 58,553,724		probably null	Het
Gm5592	T	C	7: 41,155,830		probably benign	Het
Ipp	A	G	4: 116,537,876	Y536C	probably damaging	Het
Krt72	T	C	15: 101,778,305	E402G	probably damaging	Het
Lamb3	T	C	1: 193,332,330	L599P	probably damaging	Het
Lingo2	T	A	4: 35,709,120	T287S	probably benign	Het
Lipo3	T	A	19: 33,559,625	T232S	probably benign	Het
Lrrc63	G	A	14: 75,126,110	H194Y	probably benign	Het
Map3k13	A	G	16: 21,906,524	T416A	probably benign	Het
Mcm3	A	T	1: 20,804,929		probably null	Het
Mms22l	T	C	4: 24,517,223	V258A	probably benign	Het
Mrpl46	A	T	7: 78,782,883	L49*	probably null	Het
Mrs2	T	C	13: 24,993,759	T369A	possibly damaging	Het
Mtrf1	T	A	14: 79,419,268	Y403*	probably null	Het
Mup21	C	T	4: 62,150,727	C9Y	unknown	Het
Mup-ps21	A	T	4: 62,030,770		noncoding transcript	Het
Mybph	T	G	1: 134,197,343		probably null	Het
Mypn	A	G	10: 63,134,923		probably benign	Het
Nav2	T	C	7: 49,408,683	S124P	probably damaging	Het
Nrros	T	C	16: 32,143,423	D556G	probably damaging	Het
Numa1	A	C	7: 101,999,677	I872L	probably benign	Het
Olfr1206	A	T	2: 88,864,928	M108L	probably benign	Het
Olfr13	C	T	6: 43,174,004	T6I	probably benign	Het
Olfr293	A	G	7: 86,664,336	I225V	possibly damaging	Het
Olfr472	T	A	7: 107,903,239	I174K	probably damaging	Het
Olfr92	G	C	17: 37,111,455	L176V	probably benign	Het
Pcdhb9	A	T	18: 37,402,255	N434I	probably damaging	Het
Pigq	A	T	17: 25,936,762		probably null	Het
Plxna2	T	G	1: 194,788,837	V972G	probably damaging	Het
Psma3	G	A	12: 70,988,495		probably benign	Het
Ptpn13	A	G	5: 103,556,109	T1336A	probably benign	Het
Rdh7	T	C	10: 127,884,729	D258G	probably benign	Het
Serpinb6c	A	G	13: 33,899,269	I54T	probably damaging	Het
Sh2d7	A	T	9: 54,541,349	Y218F	probably benign	Het
Slc12a8	A	T	16: 33,550,904	I137F	possibly damaging	Het
Smarca2	T	C	19: 26,706,200	V1153A	possibly damaging	Het
Smc6	A	T	12: 11,289,164	I334L	probably benign	Het
Sorcs1	A	G	19: 50,241,942		probably benign	Het
Taar8c	A	G	10: 24,101,503	L137P	probably damaging	Het
Tcam1	A	T	11: 106,285,426	D326V	possibly damaging	Het
Telo2	A	T	17: 25,105,823	V461D	probably benign	Het
Tmprss7	A	T	16: 45,677,962	C351*	probably null	Het
Trim66	T	A	7: 109,454,992		probably benign	Het
Ube2d1	G	T	10: 71,262,110	H32N	probably benign	Het
Ubp1	T	C	9: 113,964,668		probably benign	Het
Vma21	C	T	X: 71,820,157	T81M	probably damaging	Het
Vmn1r113	T	C	7: 20,787,420	S46P	probably benign	Het
Wars	T	C	12: 108,866,018	S374G	probably benign	Het
Wbp1	T	C	6: 83,119,345	D277G	possibly damaging	Het
Zfp939	C	A	7: 39,473,785		noncoding transcript	Het

Other mutations in Muc20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01953:Muc20	APN	16	32793703	missense	probably benign	0.10
IGL02016:Muc20	APN	16	32797352	missense	possibly damaging	0.46
IGL02092:Muc20	APN	16	32794272	missense	probably damaging	0.99
IGL02415:Muc20	APN	16	32794681	missense	unknown
R6669_muc20_072	UTSW	16	32793937	missense	possibly damaging	0.94
R0552:Muc20	UTSW	16	32793930	missense	probably damaging	0.98
R0629:Muc20	UTSW	16	32793421	missense	possibly damaging	0.66
R0725:Muc20	UTSW	16	32793488	missense	probably benign	0.05
R1676:Muc20	UTSW	16	32794279	missense	probably damaging	1.00
R1771:Muc20	UTSW	16	32793852	missense	probably damaging	0.97
R1778:Muc20	UTSW	16	32794141	missense	possibly damaging	0.49
R1967:Muc20	UTSW	16	32794242	missense	probably benign	0.03
R2104:Muc20	UTSW	16	32794177	missense	probably damaging	0.99
R3054:Muc20	UTSW	16	32779029	missense	probably benign	0.18
R4704:Muc20	UTSW	16	32779074	missense	possibly damaging	0.70
R4893:Muc20	UTSW	16	32794672	missense	possibly damaging	0.66
R4986:Muc20	UTSW	16	32777635	intron	probably benign
R5191:Muc20	UTSW	16	32794476	missense	unknown
R5195:Muc20	UTSW	16	32794476	missense	unknown
R5875:Muc20	UTSW	16	32793819	missense	possibly damaging	0.93
R5931:Muc20	UTSW	16	32794574	missense	possibly damaging	0.81
R6434:Muc20	UTSW	16	32794806	missense	probably benign	0.01
R6523:Muc20	UTSW	16	32793450	missense	possibly damaging	0.90
R6580:Muc20	UTSW	16	32793489	missense	possibly damaging	0.77
R6669:Muc20	UTSW	16	32793937	missense	possibly damaging	0.94
R7028:Muc20	UTSW	16	32794246	missense	probably benign	0.03
R7681:Muc20	UTSW	16	32793619	missense	probably benign	0.34
R7722:Muc20	UTSW	16	32797386	missense	probably benign	0.00
W0251:Muc20	UTSW	16	32793853	missense	possibly damaging	0.91
X0011:Muc20	UTSW	16	32793252	missense	possibly damaging	0.79

Predicted Primers

PCR Primer
(F):5'- TTGAAACCGTTCTGGTCTCCGTTAC -3'
(R):5'- CGCAAACTCTCAGCACTGAATCTGC -3'

Sequencing Primer
(F):5'- GTCAATTCAATAGGTGAGATGGTC -3'
(R):5'- TCAGTTCAGAGGTCAATTCCAGAG -3'

Posted On

2014-08-21