Incidental Mutation 'R0669:Adamts5'
ID 218866
Institutional Source Beutler Lab
Gene Symbol Adamts5
Ensembl Gene ENSMUSG00000022894
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)
Synonyms 9530092O11Rik, ADAM-TS5
MMRRC Submission 038854-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.161) question?
Stock # R0669 (G1)
Quality Score 22
Status Validated
Chromosome 16
Chromosomal Location 85856173-85901828 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85899726 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 181 (I181T)
Ref Sequence ENSEMBL: ENSMUSP00000023611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023611]
AlphaFold Q9R001
Predicted Effect probably benign
Transcript: ENSMUST00000023611
AA Change: I181T

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: I181T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 182 9.1e-18 PFAM
low complexity region 226 232 N/A INTRINSIC
Pfam:Reprolysin_5 265 450 2.1e-16 PFAM
Pfam:Reprolysin_4 265 472 4.8e-14 PFAM
Pfam:Reprolysin 267 476 4.6e-26 PFAM
Pfam:Reprolysin_2 286 466 3.7e-13 PFAM
Pfam:Reprolysin_3 288 421 6.9e-17 PFAM
Blast:ACR 477 555 4e-15 BLAST
low complexity region 556 566 N/A INTRINSIC
TSP1 570 622 6.04e-13 SMART
Pfam:ADAM_spacer1 732 852 1.7e-35 PFAM
TSP1 878 926 7.12e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T A 11: 72,198,845 H71L possibly damaging Het
A230050P20Rik AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA 9: 20,873,717 probably benign Het
Abcb11 C A 2: 69,329,318 V10L probably benign Het
Abcb9 T C 5: 124,062,887 T689A probably damaging Het
Adam22 A G 5: 8,143,036 probably benign Het
Adamts9 A T 6: 92,880,957 V231D probably damaging Het
Angptl6 C T 9: 20,876,527 V197M probably damaging Het
Atp6v1c1 T C 15: 38,677,528 V99A probably benign Het
Cacna2d3 A G 14: 29,467,949 V110A probably benign Het
Ccdc32 A G 2: 119,019,167 probably benign Het
Cela3b T C 4: 137,428,530 H22R probably benign Het
Cep44 T C 8: 56,540,973 T190A possibly damaging Het
Chsy1 T C 7: 66,171,687 C557R probably damaging Het
Cntd1 A G 11: 101,287,498 T308A probably damaging Het
Cutal T C 2: 34,885,866 probably benign Het
Dgcr14 T C 16: 17,907,555 Y221C probably damaging Het
Dna2 A G 10: 62,956,989 D261G probably damaging Het
Dnhd1 T A 7: 105,693,704 S1418R probably benign Het
Dnpep A G 1: 75,311,778 probably benign Het
Dock7 A T 4: 98,987,479 Y1075N probably benign Het
Eif2s1 C T 12: 78,881,238 probably benign Het
Fam69b A G 2: 26,634,866 T93A probably benign Het
Fer1l6 T C 15: 58,553,724 probably null Het
Gm5592 T C 7: 41,155,830 probably benign Het
Ipp A G 4: 116,537,876 Y536C probably damaging Het
Krt72 T C 15: 101,778,305 E402G probably damaging Het
Lamb3 T C 1: 193,332,330 L599P probably damaging Het
Lingo2 T A 4: 35,709,120 T287S probably benign Het
Lipo3 T A 19: 33,559,625 T232S probably benign Het
Lrrc63 G A 14: 75,126,110 H194Y probably benign Het
Map3k13 A G 16: 21,906,524 T416A probably benign Het
Mcm3 A T 1: 20,804,929 probably null Het
Mms22l T C 4: 24,517,223 V258A probably benign Het
Mrpl46 A T 7: 78,782,883 L49* probably null Het
Mrs2 T C 13: 24,993,759 T369A possibly damaging Het
Mtrf1 T A 14: 79,419,268 Y403* probably null Het
Muc20 G A 16: 32,794,480 P176S unknown Het
Mup21 C T 4: 62,150,727 C9Y unknown Het
Mup-ps21 A T 4: 62,030,770 noncoding transcript Het
Mybph T G 1: 134,197,343 probably null Het
Mypn A G 10: 63,134,923 probably benign Het
Nav2 T C 7: 49,408,683 S124P probably damaging Het
Nrros T C 16: 32,143,423 D556G probably damaging Het
Numa1 A C 7: 101,999,677 I872L probably benign Het
Olfr1206 A T 2: 88,864,928 M108L probably benign Het
Olfr13 C T 6: 43,174,004 T6I probably benign Het
Olfr293 A G 7: 86,664,336 I225V possibly damaging Het
Olfr472 T A 7: 107,903,239 I174K probably damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pcdhb9 A T 18: 37,402,255 N434I probably damaging Het
Pigq A T 17: 25,936,762 probably null Het
Plxna2 T G 1: 194,788,837 V972G probably damaging Het
Psma3 G A 12: 70,988,495 probably benign Het
Ptpn13 A G 5: 103,556,109 T1336A probably benign Het
Rdh7 T C 10: 127,884,729 D258G probably benign Het
Serpinb6c A G 13: 33,899,269 I54T probably damaging Het
Sh2d7 A T 9: 54,541,349 Y218F probably benign Het
Slc12a8 A T 16: 33,550,904 I137F possibly damaging Het
Smarca2 T C 19: 26,706,200 V1153A possibly damaging Het
Smc6 A T 12: 11,289,164 I334L probably benign Het
Sorcs1 A G 19: 50,241,942 probably benign Het
Taar8c A G 10: 24,101,503 L137P probably damaging Het
Tcam1 A T 11: 106,285,426 D326V possibly damaging Het
Telo2 A T 17: 25,105,823 V461D probably benign Het
Tmprss7 A T 16: 45,677,962 C351* probably null Het
Trim66 T A 7: 109,454,992 probably benign Het
Ube2d1 G T 10: 71,262,110 H32N probably benign Het
Ubp1 T C 9: 113,964,668 probably benign Het
Vma21 C T X: 71,820,157 T81M probably damaging Het
Vmn1r113 T C 7: 20,787,420 S46P probably benign Het
Wars T C 12: 108,866,018 S374G probably benign Het
Wbp1 T C 6: 83,119,345 D277G possibly damaging Het
Zfp939 C A 7: 39,473,785 noncoding transcript Het
Other mutations in Adamts5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Adamts5 APN 16 85899834 missense probably damaging 1.00
IGL01070:Adamts5 APN 16 85863133 missense probably damaging 1.00
IGL01321:Adamts5 APN 16 85899475 missense probably benign 0.03
IGL01616:Adamts5 APN 16 85887814 splice site probably null
IGL02551:Adamts5 APN 16 85870038 missense possibly damaging 0.71
IGL03263:Adamts5 APN 16 85869942 missense probably damaging 0.99
IGL03295:Adamts5 APN 16 85877945 missense probably damaging 1.00
IGL03393:Adamts5 APN 16 85868195 missense probably damaging 0.99
IGL03403:Adamts5 APN 16 85863014 missense probably damaging 0.97
R0414:Adamts5 UTSW 16 85877906 missense probably damaging 1.00
R0419:Adamts5 UTSW 16 85866642 missense probably benign 0.00
R0539:Adamts5 UTSW 16 85868692 missense probably damaging 1.00
R0570:Adamts5 UTSW 16 85899247 missense probably damaging 1.00
R0574:Adamts5 UTSW 16 85899484 missense probably damaging 0.99
R1454:Adamts5 UTSW 16 85869993 missense possibly damaging 0.88
R1498:Adamts5 UTSW 16 85900102 missense possibly damaging 0.63
R1729:Adamts5 UTSW 16 85877915 nonsense probably null
R1753:Adamts5 UTSW 16 85899352 missense probably damaging 1.00
R1784:Adamts5 UTSW 16 85877915 nonsense probably null
R1906:Adamts5 UTSW 16 85868685 nonsense probably null
R1946:Adamts5 UTSW 16 85899243 missense probably damaging 1.00
R2180:Adamts5 UTSW 16 85887924 missense probably damaging 1.00
R2223:Adamts5 UTSW 16 85899306 missense probably damaging 1.00
R2366:Adamts5 UTSW 16 85862758 missense probably damaging 1.00
R3889:Adamts5 UTSW 16 85868121 missense probably damaging 1.00
R4214:Adamts5 UTSW 16 85868643 missense probably damaging 1.00
R4909:Adamts5 UTSW 16 85900066 nonsense probably null
R5119:Adamts5 UTSW 16 85899578 missense probably benign 0.00
R5230:Adamts5 UTSW 16 85870068 missense probably damaging 0.97
R5452:Adamts5 UTSW 16 85869912 critical splice donor site probably benign
R5652:Adamts5 UTSW 16 85899268 missense probably damaging 1.00
R5831:Adamts5 UTSW 16 85868118 missense probably damaging 1.00
R6045:Adamts5 UTSW 16 85899300 missense probably damaging 0.99
R6259:Adamts5 UTSW 16 85899753 missense probably benign 0.03
R6384:Adamts5 UTSW 16 85862828 missense probably benign 0.00
R6724:Adamts5 UTSW 16 85868557 missense probably benign 0.06
R6829:Adamts5 UTSW 16 85870071 missense possibly damaging 0.52
R7066:Adamts5 UTSW 16 85862764 missense probably damaging 1.00
R7256:Adamts5 UTSW 16 85863035 missense probably damaging 1.00
R7293:Adamts5 UTSW 16 85899945 missense probably benign 0.10
R7298:Adamts5 UTSW 16 85899918 missense probably benign 0.35
R7384:Adamts5 UTSW 16 85899826 missense probably benign 0.02
R7452:Adamts5 UTSW 16 85877981 missense probably benign 0.00
R7727:Adamts5 UTSW 16 85899966 missense probably damaging 1.00
R7785:Adamts5 UTSW 16 85863004 missense probably damaging 0.99
R7894:Adamts5 UTSW 16 85877920 nonsense probably null
R8111:Adamts5 UTSW 16 85899315 missense probably damaging 1.00
R8370:Adamts5 UTSW 16 85899993 missense possibly damaging 0.74
R8413:Adamts5 UTSW 16 85866618 critical splice donor site probably null
R8505:Adamts5 UTSW 16 85900056 missense probably benign 0.42
R8804:Adamts5 UTSW 16 85869912 critical splice donor site probably benign
R9209:Adamts5 UTSW 16 85870083 missense probably damaging 1.00
R9455:Adamts5 UTSW 16 85870129 missense probably damaging 0.99
R9616:Adamts5 UTSW 16 85862786 missense probably benign 0.34
X0062:Adamts5 UTSW 16 85863157 missense probably damaging 1.00
Z1177:Adamts5 UTSW 16 85870074 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCAGATGGCGAGAAAGCTGAG -3'
(R):5'- AACTCTACTCTGGCGGTGGCAAAG -3'

Sequencing Primer
(F):5'- AGCTGAGTGGTCCAGCAG -3'
(R):5'- AAAGTGGGCTACCTTGTCTACG -3'
Posted On 2014-08-21