Mutagenetix > Incidental Mutation

Incidental Mutation 'R0726:Med13l'

218870

Institutional Source

Beutler Lab

Gene Symbol

Med13l

Ensembl Gene

ENSMUSG00000018076

Gene Name

mediator complex subunit 13-like

Synonyms

9030618F05Rik, Thrap2, 6330591G05Rik, 2210413I17Rik, Trap240L

MMRRC Submission

038908-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.963) question?

Stock #

R0726 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

118560679-118765438 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 118748684 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 1550 (N1550I)

Ref Sequence

ENSEMBL: ENSMUSP00000144092 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100816] [ENSMUST00000201010]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000100816
AA Change: N1550I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000098379
Gene: ENSMUSG00000018076
AA Change: N1550I

Domain	Start	End	E-Value	Type
Pfam:Med13_N	1	380	2.5e-116	PFAM
low complexity region	442	460	N/A	INTRINSIC
low complexity region	542	558	N/A	INTRINSIC
low complexity region	1020	1031	N/A	INTRINSIC
low complexity region	1044	1060	N/A	INTRINSIC
low complexity region	1541	1593	N/A	INTRINSIC
low complexity region	1601	1611	N/A	INTRINSIC
Pfam:Med13_C	1675	2197	1e-142	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000201010
AA Change: N1550I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000144092
Gene: ENSMUSG00000018076
AA Change: N1550I

Domain	Start	End	E-Value	Type
Pfam:Med13_N	1	380	1e-112	PFAM
low complexity region	442	460	N/A	INTRINSIC
low complexity region	542	558	N/A	INTRINSIC
low complexity region	1020	1031	N/A	INTRINSIC
low complexity region	1044	1060	N/A	INTRINSIC
low complexity region	1541	1593	N/A	INTRINSIC
low complexity region	1601	1611	N/A	INTRINSIC
Pfam:Med13_C	1675	2206	1.7e-138	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202538

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202787

Meta Mutation Damage Score

0.1238

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.1%
20x: 89.2%

Validation Efficiency

98% (90/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the Mediator complex, a large complex of proteins that functions as a transcriptional coactivator for most RNA polymerase II-transcribed genes. The encoded protein is involved in early development of the heart and brain. Defects in this gene are a cause of transposition of the great arteries, dextro-looped (DTGA).[provided by RefSeq, Jul 2010]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alg12	T	C	15: 88,806,647	Y256C	probably damaging	Het
Alox15	T	A	11: 70,350,195	D160V	probably damaging	Het
Aox2	T	C	1: 58,334,782		probably benign	Het
Bbs9	G	T	9: 22,793,823	A729S	probably damaging	Het
Bmp2k	T	A	5: 97,087,494		probably benign	Het
Braf	C	T	6: 39,662,148	R223Q	possibly damaging	Het
Cd101	A	T	3: 101,020,622	S48T	possibly damaging	Het
Cdh9	T	G	15: 16,831,044	D322E	probably benign	Het
Col28a1	C	T	6: 8,014,495		probably null	Het
Cpxm1	G	A	2: 130,390,939	R712W	probably damaging	Het
Csnk1g1	T	C	9: 66,032,355		probably benign	Het
Cyp2d37-ps	A	C	15: 82,690,449		noncoding transcript	Het
Cyth3	T	C	5: 143,692,642	V115A	probably benign	Het
Dnah9	C	T	11: 65,965,681	V2885M	probably damaging	Het
Dock9	G	T	14: 121,651,768	Y326*	probably null	Het
Espl1	T	C	15: 102,322,598	I1844T	probably benign	Het
Fam105a	A	T	15: 27,656,947	I338N	probably damaging	Het
Fam20a	T	A	11: 109,677,194	N357Y	probably damaging	Het
Fancc	C	A	13: 63,323,411	R385L	probably benign	Het
Foxe3	A	T	4: 114,925,250	L255H	unknown	Het
Frem2	T	C	3: 53,519,626	D2967G	possibly damaging	Het
Gabra6	T	G	11: 42,315,127	T301P	probably damaging	Het
Ganab	T	A	19: 8,911,113	Y511N	probably damaging	Het
Gm498	A	G	7: 143,871,761	D49G	probably damaging	Het
Grm4	T	A	17: 27,438,438		probably benign	Het
Hist1h1t	G	T	13: 23,696,324	K153N	possibly damaging	Het
Kcnj9	G	A	1: 172,325,921	S212F	probably damaging	Het
Kif15	C	A	9: 122,959,928	H62N	probably benign	Het
Kptn	A	G	7: 16,120,722	D106G	probably damaging	Het
Krtap13-1	T	A	16: 88,729,304	S139T	probably damaging	Het
Lepr	C	A	4: 101,764,934	N354K	probably benign	Het
Lypd3	G	T	7: 24,638,544	E112*	probably null	Het
Mettl2	C	T	11: 105,126,844	P60L	probably benign	Het
Muc4	A	G	16: 32,769,827	E850G	probably damaging	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Nek1	A	G	8: 61,089,592	R739G	probably damaging	Het
Nipbl	A	T	15: 8,351,555	D584E	probably benign	Het
Nkain3	C	T	4: 20,158,388	V162M	possibly damaging	Het
Nmrk1	T	C	19: 18,641,480		probably benign	Het
Nsd2	T	C	5: 33,861,028		probably benign	Het
Olfr1198	A	T	2: 88,746,008	N293K	probably benign	Het
Olfr1270	T	A	2: 90,149,283	H241L	probably damaging	Het
Olfr133	T	C	17: 38,148,624	F12S	probably damaging	Het
Olfr1449	T	A	19: 12,935,605	V289D	probably damaging	Het
Olfr907	T	A	9: 38,499,122	M151K	possibly damaging	Het
Phex	T	A	X: 157,372,561		probably benign	Het
Pip5k1b	G	T	19: 24,378,892	D227E	probably damaging	Het
Prdm13	A	G	4: 21,683,914	I119T	unknown	Het
Rab19	G	T	6: 39,383,959	V14L	probably benign	Het
Rasa3	A	G	8: 13,580,118		probably benign	Het
Rgsl1	C	T	1: 153,802,328	S118N	probably damaging	Het
Rif1	C	T	2: 52,110,353	T1273M	possibly damaging	Het
Scn8a	A	G	15: 100,972,830	N254S	probably damaging	Het
Sema6a	T	C	18: 47,291,981	T188A	probably damaging	Het
Sh3pxd2a	C	T	19: 47,268,762	E506K	probably damaging	Het
Smarca2	A	T	19: 26,698,403	K1014N	probably damaging	Het
Smarca4	T	G	9: 21,700,139		probably null	Het
Sntb1	T	C	15: 55,676,356	R361G	probably benign	Het
Soga1	G	T	2: 157,060,262	R278S	probably damaging	Het
Stx5a	T	A	19: 8,754,911	I208N	probably damaging	Het
Tas2r102	T	A	6: 132,762,452	W108R	probably damaging	Het
Tcl1	A	G	12: 105,218,670	Y94H	probably damaging	Het
Tenm3	T	A	8: 48,236,594	Y1986F	probably damaging	Het
Tet2	G	A	3: 133,468,184	P1439L	probably benign	Het
Tiam2	T	C	17: 3,512,833		probably benign	Het
Ubap2l	G	A	3: 90,021,246	T526M	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Uhrf1bp1	T	C	17: 27,885,489	V503A	possibly damaging	Het
Ushbp1	T	A	8: 71,388,747		probably benign	Het
Usp28	C	T	9: 49,003,869	R115C	probably damaging	Het
Vldlr	A	T	19: 27,238,386	D261V	probably damaging	Het
Vmn2r5	C	T	3: 64,503,765	D461N	probably benign	Het
Vmn2r86	A	T	10: 130,446,396	F784I	probably damaging	Het
Zfp59	A	T	7: 27,854,088	I322F	probably damaging	Het
Zfp607a	A	T	7: 27,879,149	H548L	probably benign	Het
Zfp626	G	A	7: 27,818,623	C343Y	probably damaging	Het

Other mutations in Med13l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Med13l	APN	5	118724071	missense	probably damaging	0.99
IGL01012:Med13l	APN	5	118734028	missense	probably damaging	0.99
IGL01316:Med13l	APN	5	118762781	missense	probably damaging	1.00
IGL01529:Med13l	APN	5	118742335	missense	probably damaging	1.00
IGL01731:Med13l	APN	5	118742407	missense	probably benign	0.05
IGL01790:Med13l	APN	5	118593522	missense	probably damaging	1.00
IGL02394:Med13l	APN	5	118748833	missense	probably benign	0.37
IGL02432:Med13l	APN	5	118738400	missense	possibly damaging	0.90
IGL02698:Med13l	APN	5	118762829	missense	probably damaging	0.99
IGL02801:Med13l	APN	5	118745113	missense	probably damaging	1.00
IGL03242:Med13l	APN	5	118747445	missense	probably benign
IGL03270:Med13l	APN	5	118731430	missense	probably damaging	1.00
Basics	UTSW	5	118759264	critical splice donor site	probably null
firmament	UTSW	5	118745006	splice site	probably null
Fundament	UTSW	5	118721474	missense	probably damaging	1.00
Root	UTSW	5	118593445	missense	probably damaging	1.00
P0035:Med13l	UTSW	5	118742620	missense	probably benign	0.00
R0051:Med13l	UTSW	5	118742655	missense	probably damaging	1.00
R0051:Med13l	UTSW	5	118742655	missense	probably damaging	1.00
R0136:Med13l	UTSW	5	118724050	missense	probably benign	0.15
R0158:Med13l	UTSW	5	118742449	missense	unknown
R0197:Med13l	UTSW	5	118671002	splice site	probably benign
R0370:Med13l	UTSW	5	118741826	missense	probably benign	0.14
R0492:Med13l	UTSW	5	118738495	missense	probably damaging	1.00
R0532:Med13l	UTSW	5	118759123	missense	possibly damaging	0.78
R0738:Med13l	UTSW	5	118751633	missense	probably damaging	0.99
R0827:Med13l	UTSW	5	118726247	splice site	probably benign
R0883:Med13l	UTSW	5	118671002	splice site	probably benign
R0959:Med13l	UTSW	5	118754285	missense	possibly damaging	0.89
R1458:Med13l	UTSW	5	118738459	missense	probably benign	0.00
R1562:Med13l	UTSW	5	118738519	missense	probably damaging	1.00
R1577:Med13l	UTSW	5	118721392	missense	probably damaging	1.00
R1661:Med13l	UTSW	5	118749748	missense	probably damaging	1.00
R1665:Med13l	UTSW	5	118749748	missense	probably damaging	1.00
R1720:Med13l	UTSW	5	118741995	missense	probably damaging	1.00
R1929:Med13l	UTSW	5	118728833	missense	probably benign	0.01
R1967:Med13l	UTSW	5	118761322	missense	probably damaging	0.99
R2301:Med13l	UTSW	5	118593447	missense	probably damaging	1.00
R3691:Med13l	UTSW	5	118721497	missense	probably benign	0.16
R3895:Med13l	UTSW	5	118761323	missense	probably null	0.99
R4043:Med13l	UTSW	5	118593463	missense	probably damaging	1.00
R4593:Med13l	UTSW	5	118742560	missense	probably damaging	1.00
R4902:Med13l	UTSW	5	118745130	missense	probably damaging	1.00
R4995:Med13l	UTSW	5	118730949	missense	possibly damaging	0.90
R5010:Med13l	UTSW	5	118593550	missense	possibly damaging	0.95
R5057:Med13l	UTSW	5	118718493	missense	probably damaging	1.00
R5369:Med13l	UTSW	5	118724010	missense	probably benign	0.02
R5446:Med13l	UTSW	5	118742397	missense	possibly damaging	0.81
R5564:Med13l	UTSW	5	118742040	missense	probably damaging	1.00
R5566:Med13l	UTSW	5	118728665	missense	possibly damaging	0.95
R5580:Med13l	UTSW	5	118751630	missense	possibly damaging	0.95
R5634:Med13l	UTSW	5	118560850	missense	possibly damaging	0.88
R5748:Med13l	UTSW	5	118593445	missense	probably damaging	1.00
R5764:Med13l	UTSW	5	118728642	missense	probably damaging	0.99
R5765:Med13l	UTSW	5	118728642	missense	probably damaging	0.99
R6083:Med13l	UTSW	5	118721486	missense	possibly damaging	0.80
R6504:Med13l	UTSW	5	118754321	missense	probably benign	0.34
R6546:Med13l	UTSW	5	118721474	missense	probably damaging	1.00
R6797:Med13l	UTSW	5	118759264	critical splice donor site	probably null
R6911:Med13l	UTSW	5	118755658	missense	possibly damaging	0.95
R6942:Med13l	UTSW	5	118745006	splice site	probably null
R7018:Med13l	UTSW	5	118751986	missense	probably damaging	0.99
R7096:Med13l	UTSW	5	118721926	missense	possibly damaging	0.90
R7113:Med13l	UTSW	5	118726265	missense	probably benign	0.09
R7136:Med13l	UTSW	5	118721522	missense	possibly damaging	0.90
R7140:Med13l	UTSW	5	118741972	missense	probably benign	0.27
R7345:Med13l	UTSW	5	118742760	missense	probably damaging	1.00
R7409:Med13l	UTSW	5	118754321	missense	probably benign	0.34
R7410:Med13l	UTSW	5	118560832	missense	possibly damaging	0.94
R7432:Med13l	UTSW	5	118751938	missense	probably damaging	0.99
R7486:Med13l	UTSW	5	118728474	missense	probably benign	0.17
R7509:Med13l	UTSW	5	118748930	missense	probably damaging	0.97
R7722:Med13l	UTSW	5	118747407	missense	probably benign	0.32
R7802:Med13l	UTSW	5	118728590	missense	probably benign	0.03
R8081:Med13l	UTSW	5	118728268	missense	probably damaging	1.00
R8260:Med13l	UTSW	5	118748729	missense	possibly damaging	0.95
R8266:Med13l	UTSW	5	118742109	missense	probably damaging	1.00
R8347:Med13l	UTSW	5	118742597	missense	probably benign
R8365:Med13l	UTSW	5	118728644	missense	possibly damaging	0.81
R8508:Med13l	UTSW	5	118754321	missense	probably benign	0.34
R8920:Med13l	UTSW	5	118747478	nonsense	probably null
R8970:Med13l	UTSW	5	118745099	missense	probably damaging	1.00
R8994:Med13l	UTSW	5	118728161	missense	possibly damaging	0.78
R9045:Med13l	UTSW	5	118742751	missense	probably benign
R9401:Med13l	UTSW	5	118745024	missense	probably benign	0.14
R9445:Med13l	UTSW	5	118724149	missense	probably benign	0.00
R9446:Med13l	UTSW	5	118738502	missense	probably benign	0.11
R9714:Med13l	UTSW	5	118728373	missense	probably benign	0.44
R9777:Med13l	UTSW	5	118748959	missense	probably benign
R9781:Med13l	UTSW	5	118729967	missense	possibly damaging	0.60
R9797:Med13l	UTSW	5	118742079	missense	probably damaging	1.00
X0065:Med13l	UTSW	5	118729883	missense	probably damaging	1.00
Z1088:Med13l	UTSW	5	118749641	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GTTCTCAGTGACATCAGAAAAGGAGGC -3'
(R):5'- CCACCGAATCCTGAAGAAGAGGTAGTG -3'

Sequencing Primer
(F):5'- CCTGTAAGCCAAATGTAGAATTGAC -3'
(R):5'- TCCTGAAGAAGAGGTAGTGTTCATC -3'

Posted On

2014-08-22