Incidental Mutation 'R0726:Dnah9'
ID 218879
Institutional Source Beutler Lab
Gene Symbol Dnah9
Ensembl Gene ENSMUSG00000056752
Gene Name dynein, axonemal, heavy chain 9
Synonyms D11Ertd686e, Dnahc9
MMRRC Submission 038908-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.400) question?
Stock # R0726 (G1)
Quality Score 37
Status Validated
Chromosome 11
Chromosomal Location 65722150-66059379 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 65856507 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 2885 (V2885M)
Ref Sequence ENSEMBL: ENSMUSP00000079494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080665]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000080665
AA Change: V2885M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752
AA Change: V2885M

DomainStartEndE-ValueType
Pfam:DHC_N1 209 787 3.6e-164 PFAM
coiled coil region 788 820 N/A INTRINSIC
low complexity region 1228 1240 N/A INTRINSIC
Pfam:DHC_N2 1290 1699 1.4e-134 PFAM
AAA 1863 1999 4.9e-1 SMART
AAA 2141 2341 1.99e0 SMART
AAA 2468 2614 6.75e-1 SMART
Pfam:AAA_8 2786 3053 1.1e-165 PFAM
Pfam:MT 3065 3408 7.2e-208 PFAM
Pfam:AAA_9 3430 3652 3.2e-87 PFAM
Pfam:Dynein_heavy 3786 4482 1e-241 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000152386
AA Change: V434M
SMART Domains Protein: ENSMUSP00000116499
Gene: ENSMUSG00000056752
AA Change: V434M

DomainStartEndE-ValueType
Pfam:AAA_7 1 258 3e-155 PFAM
Pfam:AAA_8 336 603 3.9e-166 PFAM
Pfam:MT 615 958 2.3e-208 PFAM
Pfam:AAA_9 980 1202 1.1e-87 PFAM
Pfam:Dynein_heavy 1336 1514 2.4e-52 PFAM
Pfam:Dynein_heavy 1508 1956 8.6e-155 PFAM
Meta Mutation Damage Score 0.2053 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 89.2%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acte1 A G 7: 143,425,498 (GRCm39) D49G probably damaging Het
Alg12 T C 15: 88,690,850 (GRCm39) Y256C probably damaging Het
Alox15 T A 11: 70,241,021 (GRCm39) D160V probably damaging Het
Aox1 T C 1: 58,373,941 (GRCm39) probably benign Het
Bbs9 G T 9: 22,705,119 (GRCm39) A729S probably damaging Het
Bltp3a T C 17: 28,104,463 (GRCm39) V503A possibly damaging Het
Bmp2k T A 5: 97,235,353 (GRCm39) probably benign Het
Braf C T 6: 39,639,082 (GRCm39) R223Q possibly damaging Het
Cd101 A T 3: 100,927,938 (GRCm39) S48T possibly damaging Het
Cdh9 T G 15: 16,831,130 (GRCm39) D322E probably benign Het
Col28a1 C T 6: 8,014,495 (GRCm39) probably null Het
Cpxm1 G A 2: 130,232,859 (GRCm39) R712W probably damaging Het
Csnk1g1 T C 9: 65,939,637 (GRCm39) probably benign Het
Cyp2d37-ps A C 15: 82,574,650 (GRCm39) noncoding transcript Het
Cyth3 T C 5: 143,678,397 (GRCm39) V115A probably benign Het
Dock9 G T 14: 121,889,180 (GRCm39) Y326* probably null Het
Espl1 T C 15: 102,231,033 (GRCm39) I1844T probably benign Het
Fam20a T A 11: 109,568,020 (GRCm39) N357Y probably damaging Het
Fancc C A 13: 63,471,225 (GRCm39) R385L probably benign Het
Foxe3 A T 4: 114,782,447 (GRCm39) L255H unknown Het
Frem2 T C 3: 53,427,047 (GRCm39) D2967G possibly damaging Het
Gabra6 T G 11: 42,205,954 (GRCm39) T301P probably damaging Het
Ganab T A 19: 8,888,477 (GRCm39) Y511N probably damaging Het
Grm4 T A 17: 27,657,412 (GRCm39) probably benign Het
H1f6 G T 13: 23,880,307 (GRCm39) K153N possibly damaging Het
Kcnj9 G A 1: 172,153,488 (GRCm39) S212F probably damaging Het
Kif15 C A 9: 122,788,993 (GRCm39) H62N probably benign Het
Kptn A G 7: 15,854,647 (GRCm39) D106G probably damaging Het
Krtap13-1 T A 16: 88,526,192 (GRCm39) S139T probably damaging Het
Lepr C A 4: 101,622,131 (GRCm39) N354K probably benign Het
Lypd3 G T 7: 24,337,969 (GRCm39) E112* probably null Het
Med13l A T 5: 118,886,749 (GRCm39) N1550I probably damaging Het
Mettl2 C T 11: 105,017,670 (GRCm39) P60L probably benign Het
Mtcl2 G T 2: 156,902,182 (GRCm39) R278S probably damaging Het
Muc4 A G 16: 32,590,201 (GRCm39) E850G probably damaging Het
Mylk G C 16: 34,699,845 (GRCm39) E403Q possibly damaging Het
Nek1 A G 8: 61,542,626 (GRCm39) R739G probably damaging Het
Nipbl A T 15: 8,381,039 (GRCm39) D584E probably benign Het
Nkain3 C T 4: 20,158,388 (GRCm39) V162M possibly damaging Het
Nmrk1 T C 19: 18,618,844 (GRCm39) probably benign Het
Nsd2 T C 5: 34,018,372 (GRCm39) probably benign Het
Or2n1b T C 17: 38,459,515 (GRCm39) F12S probably damaging Het
Or4b1 T A 2: 89,979,627 (GRCm39) H241L probably damaging Het
Or4p23 A T 2: 88,576,352 (GRCm39) N293K probably benign Het
Or5b24 T A 19: 12,912,969 (GRCm39) V289D probably damaging Het
Or8b44 T A 9: 38,410,418 (GRCm39) M151K possibly damaging Het
Otulinl A T 15: 27,657,033 (GRCm39) I338N probably damaging Het
Phex T A X: 156,155,557 (GRCm39) probably benign Het
Pip5k1b G T 19: 24,356,256 (GRCm39) D227E probably damaging Het
Prdm13 A G 4: 21,683,914 (GRCm39) I119T unknown Het
Rab19 G T 6: 39,360,893 (GRCm39) V14L probably benign Het
Rasa3 A G 8: 13,630,118 (GRCm39) probably benign Het
Rgsl1 C T 1: 153,678,074 (GRCm39) S118N probably damaging Het
Rif1 C T 2: 52,000,365 (GRCm39) T1273M possibly damaging Het
Scn8a A G 15: 100,870,711 (GRCm39) N254S probably damaging Het
Sema6a T C 18: 47,425,048 (GRCm39) T188A probably damaging Het
Sh3pxd2a C T 19: 47,257,201 (GRCm39) E506K probably damaging Het
Smarca2 A T 19: 26,675,803 (GRCm39) K1014N probably damaging Het
Smarca4 T G 9: 21,611,435 (GRCm39) probably null Het
Sntb1 T C 15: 55,539,752 (GRCm39) R361G probably benign Het
Stx5a T A 19: 8,732,275 (GRCm39) I208N probably damaging Het
Tas2r102 T A 6: 132,739,415 (GRCm39) W108R probably damaging Het
Tcl1 A G 12: 105,184,929 (GRCm39) Y94H probably damaging Het
Tenm3 T A 8: 48,689,629 (GRCm39) Y1986F probably damaging Het
Tet2 G A 3: 133,173,945 (GRCm39) P1439L probably benign Het
Tiam2 T C 17: 3,563,108 (GRCm39) probably benign Het
Ubap2l G A 3: 89,928,553 (GRCm39) T526M probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Ushbp1 T A 8: 71,841,391 (GRCm39) probably benign Het
Usp28 C T 9: 48,915,169 (GRCm39) R115C probably damaging Het
Vldlr A T 19: 27,215,786 (GRCm39) D261V probably damaging Het
Vmn2r5 C T 3: 64,411,186 (GRCm39) D461N probably benign Het
Vmn2r86 A T 10: 130,282,265 (GRCm39) F784I probably damaging Het
Zfp59 A T 7: 27,553,513 (GRCm39) I322F probably damaging Het
Zfp607a A T 7: 27,578,574 (GRCm39) H548L probably benign Het
Zfp626 G A 7: 27,518,048 (GRCm39) C343Y probably damaging Het
Other mutations in Dnah9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:Dnah9 APN 11 65,732,064 (GRCm39) splice site probably benign
IGL00805:Dnah9 APN 11 65,772,521 (GRCm39) missense probably benign 0.00
IGL00826:Dnah9 APN 11 65,880,768 (GRCm39) missense probably damaging 1.00
IGL01108:Dnah9 APN 11 65,740,806 (GRCm39) missense possibly damaging 0.93
IGL01152:Dnah9 APN 11 65,962,882 (GRCm39) missense probably damaging 1.00
IGL01353:Dnah9 APN 11 65,971,397 (GRCm39) missense probably damaging 1.00
IGL01364:Dnah9 APN 11 66,046,285 (GRCm39) missense probably damaging 1.00
IGL01479:Dnah9 APN 11 65,846,543 (GRCm39) missense probably benign 0.14
IGL01537:Dnah9 APN 11 65,838,506 (GRCm39) missense probably benign
IGL01565:Dnah9 APN 11 65,924,655 (GRCm39) missense possibly damaging 0.95
IGL01597:Dnah9 APN 11 66,009,656 (GRCm39) missense probably damaging 1.00
IGL01619:Dnah9 APN 11 65,722,441 (GRCm39) nonsense probably null
IGL01625:Dnah9 APN 11 65,935,471 (GRCm39) missense probably damaging 1.00
IGL01803:Dnah9 APN 11 66,009,655 (GRCm39) missense probably damaging 1.00
IGL01819:Dnah9 APN 11 65,998,952 (GRCm39) missense probably benign 0.33
IGL01896:Dnah9 APN 11 66,021,492 (GRCm39) missense possibly damaging 0.89
IGL01922:Dnah9 APN 11 65,965,860 (GRCm39) splice site probably benign
IGL01923:Dnah9 APN 11 66,016,061 (GRCm39) splice site probably benign
IGL02059:Dnah9 APN 11 65,963,784 (GRCm39) missense probably damaging 1.00
IGL02068:Dnah9 APN 11 65,951,871 (GRCm39) missense probably damaging 1.00
IGL02135:Dnah9 APN 11 66,008,318 (GRCm39) missense possibly damaging 0.63
IGL02146:Dnah9 APN 11 65,818,526 (GRCm39) missense probably damaging 1.00
IGL02264:Dnah9 APN 11 65,971,314 (GRCm39) splice site probably benign
IGL02325:Dnah9 APN 11 65,725,043 (GRCm39) missense probably damaging 1.00
IGL02426:Dnah9 APN 11 66,015,979 (GRCm39) missense probably benign
IGL02440:Dnah9 APN 11 65,846,072 (GRCm39) missense probably damaging 1.00
IGL02471:Dnah9 APN 11 65,838,444 (GRCm39) nonsense probably null
IGL02496:Dnah9 APN 11 65,920,189 (GRCm39) missense probably damaging 1.00
IGL02672:Dnah9 APN 11 65,818,427 (GRCm39) missense probably benign 0.02
IGL02718:Dnah9 APN 11 65,777,466 (GRCm39) missense probably damaging 0.99
IGL02832:Dnah9 APN 11 65,931,172 (GRCm39) missense probably damaging 1.00
IGL02851:Dnah9 APN 11 65,928,570 (GRCm39) splice site probably benign
IGL02859:Dnah9 APN 11 65,772,445 (GRCm39) splice site probably benign
IGL02864:Dnah9 APN 11 65,951,829 (GRCm39) missense probably damaging 1.00
IGL02954:Dnah9 APN 11 66,009,793 (GRCm39) missense probably damaging 1.00
IGL02987:Dnah9 APN 11 65,732,099 (GRCm39) missense probably benign 0.23
IGL02987:Dnah9 APN 11 65,746,098 (GRCm39) missense probably damaging 0.98
IGL03160:Dnah9 APN 11 65,998,880 (GRCm39) missense probably damaging 0.98
IGL03171:Dnah9 APN 11 65,872,067 (GRCm39) missense probably benign 0.13
IGL03180:Dnah9 APN 11 65,777,465 (GRCm39) missense probably damaging 0.99
IGL03388:Dnah9 APN 11 65,838,368 (GRCm39) missense probably damaging 1.00
anarchy UTSW 11 65,846,074 (GRCm39) missense probably damaging 0.99
sacco UTSW 11 66,058,905 (GRCm39) missense possibly damaging 0.82
Tweed UTSW 11 65,962,898 (GRCm39) missense probably damaging 0.99
vanzetti UTSW 11 65,746,198 (GRCm39) nonsense probably null
IGL02837:Dnah9 UTSW 11 65,765,022 (GRCm39) missense probably damaging 1.00
PIT4280001:Dnah9 UTSW 11 65,895,839 (GRCm39) missense probably benign 0.44
R0021:Dnah9 UTSW 11 65,860,805 (GRCm39) missense probably benign 0.36
R0021:Dnah9 UTSW 11 65,860,805 (GRCm39) missense probably benign 0.36
R0025:Dnah9 UTSW 11 65,860,781 (GRCm39) splice site probably benign
R0025:Dnah9 UTSW 11 65,860,781 (GRCm39) splice site probably benign
R0070:Dnah9 UTSW 11 66,050,866 (GRCm39) missense probably benign 0.10
R0164:Dnah9 UTSW 11 65,809,630 (GRCm39) nonsense probably null
R0164:Dnah9 UTSW 11 65,809,630 (GRCm39) nonsense probably null
R0180:Dnah9 UTSW 11 66,038,116 (GRCm39) missense probably damaging 1.00
R0195:Dnah9 UTSW 11 65,786,731 (GRCm39) missense probably benign 0.30
R0230:Dnah9 UTSW 11 65,746,141 (GRCm39) missense probably damaging 1.00
R0243:Dnah9 UTSW 11 65,802,678 (GRCm39) missense possibly damaging 0.91
R0279:Dnah9 UTSW 11 65,802,615 (GRCm39) critical splice donor site probably null
R0288:Dnah9 UTSW 11 65,915,960 (GRCm39) critical splice donor site probably null
R0309:Dnah9 UTSW 11 65,917,798 (GRCm39) splice site probably benign
R0356:Dnah9 UTSW 11 66,021,388 (GRCm39) critical splice donor site probably null
R0403:Dnah9 UTSW 11 65,975,615 (GRCm39) missense possibly damaging 0.90
R0413:Dnah9 UTSW 11 65,998,961 (GRCm39) missense probably damaging 1.00
R0448:Dnah9 UTSW 11 65,809,539 (GRCm39) splice site probably benign
R0496:Dnah9 UTSW 11 65,965,961 (GRCm39) missense probably null 1.00
R0557:Dnah9 UTSW 11 65,975,492 (GRCm39) missense probably damaging 1.00
R0584:Dnah9 UTSW 11 65,881,315 (GRCm39) missense probably damaging 1.00
R0598:Dnah9 UTSW 11 66,009,703 (GRCm39) missense probably benign 0.02
R0599:Dnah9 UTSW 11 65,856,515 (GRCm39) missense probably damaging 1.00
R0606:Dnah9 UTSW 11 65,732,159 (GRCm39) missense probably damaging 1.00
R0666:Dnah9 UTSW 11 65,976,284 (GRCm39) missense probably benign 0.01
R0715:Dnah9 UTSW 11 65,972,074 (GRCm39) splice site probably benign
R0737:Dnah9 UTSW 11 65,998,724 (GRCm39) missense probably damaging 1.00
R0763:Dnah9 UTSW 11 66,046,356 (GRCm39) missense probably benign 0.30
R0792:Dnah9 UTSW 11 65,786,827 (GRCm39) missense possibly damaging 0.84
R0829:Dnah9 UTSW 11 65,896,002 (GRCm39) missense probably benign 0.00
R0973:Dnah9 UTSW 11 65,896,663 (GRCm39) splice site probably null
R0974:Dnah9 UTSW 11 65,896,663 (GRCm39) splice site probably null
R1055:Dnah9 UTSW 11 66,050,837 (GRCm39) missense probably damaging 1.00
R1081:Dnah9 UTSW 11 65,975,703 (GRCm39) missense probably damaging 0.99
R1184:Dnah9 UTSW 11 65,975,438 (GRCm39) critical splice donor site probably null
R1225:Dnah9 UTSW 11 65,761,886 (GRCm39) missense possibly damaging 0.94
R1304:Dnah9 UTSW 11 65,818,414 (GRCm39) missense probably damaging 0.98
R1417:Dnah9 UTSW 11 65,846,573 (GRCm39) missense probably damaging 0.96
R1439:Dnah9 UTSW 11 65,764,958 (GRCm39) missense probably benign 0.22
R1447:Dnah9 UTSW 11 65,999,308 (GRCm39) missense possibly damaging 0.65
R1450:Dnah9 UTSW 11 65,818,612 (GRCm39) missense probably damaging 1.00
R1470:Dnah9 UTSW 11 65,818,648 (GRCm39) missense probably benign 0.11
R1470:Dnah9 UTSW 11 65,818,648 (GRCm39) missense probably benign 0.11
R1486:Dnah9 UTSW 11 65,725,098 (GRCm39) missense probably damaging 1.00
R1519:Dnah9 UTSW 11 65,772,587 (GRCm39) missense probably damaging 0.96
R1570:Dnah9 UTSW 11 66,003,156 (GRCm39) missense probably benign
R1617:Dnah9 UTSW 11 65,786,747 (GRCm39) missense probably damaging 1.00
R1623:Dnah9 UTSW 11 65,928,463 (GRCm39) missense probably damaging 1.00
R1626:Dnah9 UTSW 11 65,976,093 (GRCm39) missense probably benign 0.05
R1671:Dnah9 UTSW 11 65,818,789 (GRCm39) missense probably damaging 0.99
R1694:Dnah9 UTSW 11 65,845,650 (GRCm39) nonsense probably null
R1701:Dnah9 UTSW 11 65,802,750 (GRCm39) missense probably damaging 1.00
R1702:Dnah9 UTSW 11 65,976,021 (GRCm39) missense possibly damaging 0.72
R1708:Dnah9 UTSW 11 65,805,980 (GRCm39) missense probably benign 0.11
R1718:Dnah9 UTSW 11 66,058,905 (GRCm39) missense possibly damaging 0.82
R1729:Dnah9 UTSW 11 65,975,846 (GRCm39) missense possibly damaging 0.51
R1760:Dnah9 UTSW 11 65,872,048 (GRCm39) missense probably benign 0.31
R1784:Dnah9 UTSW 11 65,975,846 (GRCm39) missense possibly damaging 0.51
R1793:Dnah9 UTSW 11 66,010,420 (GRCm39) critical splice donor site probably null
R1801:Dnah9 UTSW 11 65,846,123 (GRCm39) missense probably damaging 0.99
R1827:Dnah9 UTSW 11 65,740,887 (GRCm39) missense probably damaging 0.97
R1836:Dnah9 UTSW 11 66,009,667 (GRCm39) missense probably benign 0.10
R1840:Dnah9 UTSW 11 65,725,024 (GRCm39) nonsense probably null
R1847:Dnah9 UTSW 11 65,725,212 (GRCm39) missense probably damaging 1.00
R1872:Dnah9 UTSW 11 65,928,316 (GRCm39) missense probably benign 0.16
R1929:Dnah9 UTSW 11 65,867,224 (GRCm39) missense probably benign 0.05
R1969:Dnah9 UTSW 11 65,739,197 (GRCm39) missense probably damaging 1.00
R1971:Dnah9 UTSW 11 65,739,197 (GRCm39) missense probably damaging 1.00
R2027:Dnah9 UTSW 11 65,846,164 (GRCm39) missense probably benign 0.11
R2049:Dnah9 UTSW 11 65,935,509 (GRCm39) missense probably damaging 1.00
R2064:Dnah9 UTSW 11 66,036,261 (GRCm39) missense probably benign 0.31
R2104:Dnah9 UTSW 11 65,951,950 (GRCm39) missense probably damaging 1.00
R2109:Dnah9 UTSW 11 65,928,411 (GRCm39) missense probably damaging 1.00
R2160:Dnah9 UTSW 11 66,008,309 (GRCm39) missense probably damaging 1.00
R2172:Dnah9 UTSW 11 65,963,605 (GRCm39) missense probably damaging 1.00
R2198:Dnah9 UTSW 11 65,750,325 (GRCm39) missense possibly damaging 0.50
R2271:Dnah9 UTSW 11 66,003,188 (GRCm39) missense probably benign 0.37
R2272:Dnah9 UTSW 11 66,003,188 (GRCm39) missense probably benign 0.37
R2396:Dnah9 UTSW 11 65,975,984 (GRCm39) missense probably benign 0.01
R2398:Dnah9 UTSW 11 65,806,029 (GRCm39) missense probably damaging 1.00
R2418:Dnah9 UTSW 11 65,986,241 (GRCm39) nonsense probably null
R2419:Dnah9 UTSW 11 65,986,241 (GRCm39) nonsense probably null
R2510:Dnah9 UTSW 11 65,895,995 (GRCm39) missense probably damaging 1.00
R2680:Dnah9 UTSW 11 65,924,751 (GRCm39) missense probably benign 0.00
R2875:Dnah9 UTSW 11 66,059,287 (GRCm39) missense possibly damaging 0.89
R2979:Dnah9 UTSW 11 66,008,414 (GRCm39) missense possibly damaging 0.89
R3236:Dnah9 UTSW 11 65,845,815 (GRCm39) missense probably benign 0.11
R3237:Dnah9 UTSW 11 65,845,815 (GRCm39) missense probably benign 0.11
R3433:Dnah9 UTSW 11 65,965,938 (GRCm39) missense possibly damaging 0.85
R3737:Dnah9 UTSW 11 66,047,734 (GRCm39) nonsense probably null
R3820:Dnah9 UTSW 11 65,741,829 (GRCm39) critical splice donor site probably null
R3821:Dnah9 UTSW 11 65,741,829 (GRCm39) critical splice donor site probably null
R3822:Dnah9 UTSW 11 65,741,829 (GRCm39) critical splice donor site probably null
R3861:Dnah9 UTSW 11 65,943,820 (GRCm39) splice site probably benign
R3918:Dnah9 UTSW 11 65,761,800 (GRCm39) missense possibly damaging 0.54
R4011:Dnah9 UTSW 11 65,725,290 (GRCm39) missense probably damaging 0.98
R4044:Dnah9 UTSW 11 66,024,461 (GRCm39) missense probably benign 0.03
R4072:Dnah9 UTSW 11 65,975,730 (GRCm39) missense probably benign 0.00
R4076:Dnah9 UTSW 11 65,975,730 (GRCm39) missense probably benign 0.00
R4097:Dnah9 UTSW 11 65,881,285 (GRCm39) missense probably damaging 1.00
R4409:Dnah9 UTSW 11 65,976,303 (GRCm39) missense possibly damaging 0.51
R4410:Dnah9 UTSW 11 65,976,303 (GRCm39) missense possibly damaging 0.51
R4417:Dnah9 UTSW 11 65,872,040 (GRCm39) missense possibly damaging 0.75
R4420:Dnah9 UTSW 11 66,009,575 (GRCm39) missense probably benign 0.00
R4434:Dnah9 UTSW 11 65,998,901 (GRCm39) missense possibly damaging 0.67
R4451:Dnah9 UTSW 11 65,772,467 (GRCm39) missense probably benign 0.07
R4452:Dnah9 UTSW 11 65,917,908 (GRCm39) missense probably damaging 0.96
R4454:Dnah9 UTSW 11 66,038,215 (GRCm39) missense probably damaging 0.96
R4551:Dnah9 UTSW 11 65,732,192 (GRCm39) missense probably damaging 1.00
R4552:Dnah9 UTSW 11 65,732,192 (GRCm39) missense probably damaging 1.00
R4590:Dnah9 UTSW 11 65,931,218 (GRCm39) missense probably damaging 1.00
R4595:Dnah9 UTSW 11 66,058,978 (GRCm39) missense probably benign
R4655:Dnah9 UTSW 11 65,846,558 (GRCm39) missense probably benign 0.00
R4667:Dnah9 UTSW 11 66,046,357 (GRCm39) missense probably benign
R4718:Dnah9 UTSW 11 65,976,299 (GRCm39) missense probably benign
R4720:Dnah9 UTSW 11 65,967,184 (GRCm39) missense probably damaging 1.00
R4734:Dnah9 UTSW 11 65,724,941 (GRCm39) missense probably damaging 1.00
R4749:Dnah9 UTSW 11 65,724,941 (GRCm39) missense probably damaging 1.00
R4765:Dnah9 UTSW 11 65,818,552 (GRCm39) missense probably damaging 1.00
R4905:Dnah9 UTSW 11 65,764,950 (GRCm39) nonsense probably null
R4963:Dnah9 UTSW 11 65,975,437 (GRCm39) splice site probably null
R5074:Dnah9 UTSW 11 65,740,866 (GRCm39) missense probably damaging 1.00
R5230:Dnah9 UTSW 11 65,975,492 (GRCm39) missense probably damaging 0.99
R5262:Dnah9 UTSW 11 66,003,159 (GRCm39) missense probably benign 0.34
R5364:Dnah9 UTSW 11 65,772,522 (GRCm39) missense possibly damaging 0.93
R5370:Dnah9 UTSW 11 65,920,180 (GRCm39) missense probably damaging 1.00
R5386:Dnah9 UTSW 11 65,920,182 (GRCm39) missense probably damaging 1.00
R5389:Dnah9 UTSW 11 65,986,140 (GRCm39) nonsense probably null
R5541:Dnah9 UTSW 11 66,036,162 (GRCm39) missense probably damaging 1.00
R5560:Dnah9 UTSW 11 65,772,566 (GRCm39) missense probably benign 0.00
R5576:Dnah9 UTSW 11 65,724,922 (GRCm39) splice site probably null
R5648:Dnah9 UTSW 11 65,818,581 (GRCm39) missense probably benign 0.00
R5653:Dnah9 UTSW 11 65,740,806 (GRCm39) missense probably damaging 0.99
R5713:Dnah9 UTSW 11 65,916,049 (GRCm39) missense possibly damaging 0.92
R5763:Dnah9 UTSW 11 65,846,065 (GRCm39) missense probably damaging 1.00
R5825:Dnah9 UTSW 11 66,017,427 (GRCm39) missense probably benign 0.01
R5831:Dnah9 UTSW 11 65,998,947 (GRCm39) missense probably benign 0.00
R5847:Dnah9 UTSW 11 65,986,066 (GRCm39) frame shift probably null
R5870:Dnah9 UTSW 11 65,976,036 (GRCm39) missense probably benign 0.01
R5902:Dnah9 UTSW 11 65,916,013 (GRCm39) missense probably benign 0.08
R5918:Dnah9 UTSW 11 65,725,025 (GRCm39) missense probably damaging 1.00
R5979:Dnah9 UTSW 11 65,725,307 (GRCm39) missense probably damaging 1.00
R6065:Dnah9 UTSW 11 66,036,223 (GRCm39) missense possibly damaging 0.65
R6065:Dnah9 UTSW 11 65,746,164 (GRCm39) missense probably benign 0.05
R6086:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
R6086:Dnah9 UTSW 11 65,880,741 (GRCm39) missense probably damaging 0.99
R6102:Dnah9 UTSW 11 65,881,342 (GRCm39) missense probably damaging 0.97
R6120:Dnah9 UTSW 11 66,038,225 (GRCm39) missense probably benign
R6154:Dnah9 UTSW 11 65,746,164 (GRCm39) missense probably benign 0.00
R6262:Dnah9 UTSW 11 65,772,631 (GRCm39) splice site probably null
R6265:Dnah9 UTSW 11 66,058,920 (GRCm39) missense probably benign 0.04
R6290:Dnah9 UTSW 11 65,732,201 (GRCm39) missense probably damaging 1.00
R6345:Dnah9 UTSW 11 65,928,519 (GRCm39) missense probably damaging 0.97
R6357:Dnah9 UTSW 11 65,765,022 (GRCm39) missense probably damaging 1.00
R6534:Dnah9 UTSW 11 65,846,074 (GRCm39) missense probably damaging 0.99
R6574:Dnah9 UTSW 11 66,059,107 (GRCm39) missense probably benign 0.37
R6582:Dnah9 UTSW 11 65,951,923 (GRCm39) missense probably damaging 1.00
R6700:Dnah9 UTSW 11 65,846,192 (GRCm39) missense probably damaging 1.00
R6800:Dnah9 UTSW 11 65,963,565 (GRCm39) critical splice donor site probably null
R6812:Dnah9 UTSW 11 65,872,155 (GRCm39) missense probably damaging 0.99
R6931:Dnah9 UTSW 11 66,008,452 (GRCm39) missense possibly damaging 0.63
R6944:Dnah9 UTSW 11 65,975,975 (GRCm39) missense possibly damaging 0.91
R6958:Dnah9 UTSW 11 65,967,167 (GRCm39) missense probably damaging 1.00
R6977:Dnah9 UTSW 11 65,998,735 (GRCm39) missense probably benign 0.37
R7021:Dnah9 UTSW 11 65,872,057 (GRCm39) missense probably benign
R7161:Dnah9 UTSW 11 65,746,198 (GRCm39) nonsense probably null
R7175:Dnah9 UTSW 11 66,024,463 (GRCm39) missense probably benign 0.03
R7199:Dnah9 UTSW 11 66,009,770 (GRCm39) missense probably benign 0.04
R7231:Dnah9 UTSW 11 65,856,473 (GRCm39) missense probably damaging 1.00
R7284:Dnah9 UTSW 11 65,881,302 (GRCm39) missense probably damaging 0.99
R7314:Dnah9 UTSW 11 65,880,677 (GRCm39) missense probably benign 0.00
R7350:Dnah9 UTSW 11 65,971,404 (GRCm39) missense probably damaging 1.00
R7420:Dnah9 UTSW 11 66,008,233 (GRCm39) critical splice donor site probably null
R7427:Dnah9 UTSW 11 65,846,045 (GRCm39) missense probably benign
R7477:Dnah9 UTSW 11 65,883,557 (GRCm39) missense probably damaging 0.98
R7515:Dnah9 UTSW 11 65,732,240 (GRCm39) missense probably benign 0.01
R7521:Dnah9 UTSW 11 65,880,663 (GRCm39) missense probably damaging 0.98
R7573:Dnah9 UTSW 11 66,016,041 (GRCm39) missense probably benign 0.43
R7659:Dnah9 UTSW 11 65,880,606 (GRCm39) missense probably damaging 0.99
R7707:Dnah9 UTSW 11 66,009,784 (GRCm39) missense probably damaging 1.00
R7749:Dnah9 UTSW 11 65,802,656 (GRCm39) missense probably damaging 1.00
R7792:Dnah9 UTSW 11 65,740,839 (GRCm39) missense probably damaging 1.00
R7808:Dnah9 UTSW 11 65,896,631 (GRCm39) nonsense probably null
R7814:Dnah9 UTSW 11 65,896,486 (GRCm39) missense probably damaging 1.00
R7818:Dnah9 UTSW 11 65,916,037 (GRCm39) missense possibly damaging 0.64
R7890:Dnah9 UTSW 11 65,962,898 (GRCm39) missense probably damaging 0.99
R7976:Dnah9 UTSW 11 65,732,227 (GRCm39) missense possibly damaging 0.91
R8121:Dnah9 UTSW 11 65,908,201 (GRCm39) missense probably benign 0.02
R8232:Dnah9 UTSW 11 65,746,149 (GRCm39) missense possibly damaging 0.91
R8311:Dnah9 UTSW 11 65,880,644 (GRCm39) missense probably benign 0.00
R8326:Dnah9 UTSW 11 66,008,452 (GRCm39) missense probably benign 0.01
R8338:Dnah9 UTSW 11 65,732,067 (GRCm39) critical splice donor site probably null
R8356:Dnah9 UTSW 11 66,047,764 (GRCm39) missense probably damaging 0.99
R8456:Dnah9 UTSW 11 66,047,764 (GRCm39) missense probably damaging 0.99
R8468:Dnah9 UTSW 11 65,722,556 (GRCm39) missense probably benign 0.00
R8721:Dnah9 UTSW 11 65,986,124 (GRCm39) missense probably damaging 1.00
R8747:Dnah9 UTSW 11 65,818,816 (GRCm39) missense possibly damaging 0.69
R8798:Dnah9 UTSW 11 65,796,057 (GRCm39) missense probably damaging 0.99
R8806:Dnah9 UTSW 11 65,750,309 (GRCm39) missense probably damaging 1.00
R8826:Dnah9 UTSW 11 65,740,742 (GRCm39) missense probably benign 0.13
R8837:Dnah9 UTSW 11 65,746,060 (GRCm39) missense possibly damaging 0.72
R8886:Dnah9 UTSW 11 65,943,840 (GRCm39) missense probably damaging 1.00
R8887:Dnah9 UTSW 11 65,746,210 (GRCm39) missense probably benign 0.01
R8921:Dnah9 UTSW 11 65,802,747 (GRCm39) missense probably benign
R8933:Dnah9 UTSW 11 65,746,078 (GRCm39) missense possibly damaging 0.88
R8949:Dnah9 UTSW 11 66,059,226 (GRCm39) missense possibly damaging 0.91
R8967:Dnah9 UTSW 11 66,015,938 (GRCm39) critical splice donor site probably null
R8979:Dnah9 UTSW 11 65,895,978 (GRCm39) missense probably benign
R8991:Dnah9 UTSW 11 65,777,506 (GRCm39) missense probably damaging 0.96
R9016:Dnah9 UTSW 11 65,998,856 (GRCm39) missense probably damaging 0.99
R9025:Dnah9 UTSW 11 65,896,651 (GRCm39) missense probably damaging 1.00
R9043:Dnah9 UTSW 11 65,845,680 (GRCm39) missense
R9047:Dnah9 UTSW 11 65,962,925 (GRCm39) missense possibly damaging 0.89
R9076:Dnah9 UTSW 11 66,008,464 (GRCm39) missense probably benign 0.21
R9113:Dnah9 UTSW 11 65,880,713 (GRCm39) missense probably damaging 1.00
R9152:Dnah9 UTSW 11 66,021,457 (GRCm39) missense probably damaging 1.00
R9187:Dnah9 UTSW 11 65,895,972 (GRCm39) missense probably benign
R9198:Dnah9 UTSW 11 65,846,570 (GRCm39) missense probably benign 0.02
R9203:Dnah9 UTSW 11 65,746,113 (GRCm39) missense possibly damaging 0.58
R9234:Dnah9 UTSW 11 65,924,751 (GRCm39) missense possibly damaging 0.68
R9245:Dnah9 UTSW 11 65,786,731 (GRCm39) missense probably benign 0.30
R9265:Dnah9 UTSW 11 65,732,081 (GRCm39) missense probably benign 0.01
R9307:Dnah9 UTSW 11 65,976,300 (GRCm39) missense probably benign 0.14
R9336:Dnah9 UTSW 11 65,761,775 (GRCm39) missense probably damaging 1.00
R9386:Dnah9 UTSW 11 65,838,368 (GRCm39) missense probably damaging 1.00
R9498:Dnah9 UTSW 11 65,739,199 (GRCm39) missense probably damaging 0.99
R9508:Dnah9 UTSW 11 65,725,089 (GRCm39) missense probably damaging 1.00
R9524:Dnah9 UTSW 11 65,976,309 (GRCm39) missense possibly damaging 0.92
R9577:Dnah9 UTSW 11 65,867,347 (GRCm39) missense probably benign 0.00
R9583:Dnah9 UTSW 11 65,856,507 (GRCm39) missense probably damaging 1.00
R9587:Dnah9 UTSW 11 65,999,217 (GRCm39) missense probably null 0.92
R9612:Dnah9 UTSW 11 65,818,475 (GRCm39) missense probably benign 0.00
R9748:Dnah9 UTSW 11 65,976,290 (GRCm39) missense possibly damaging 0.51
R9749:Dnah9 UTSW 11 65,986,202 (GRCm39) missense probably damaging 1.00
R9759:Dnah9 UTSW 11 65,965,944 (GRCm39) missense probably null 0.93
R9784:Dnah9 UTSW 11 65,975,960 (GRCm39) missense probably damaging 0.99
V3553:Dnah9 UTSW 11 65,860,902 (GRCm39) missense probably damaging 1.00
X0027:Dnah9 UTSW 11 65,976,305 (GRCm39) missense probably benign 0.07
X0028:Dnah9 UTSW 11 65,881,278 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,860,910 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,818,679 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,786,798 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,963,661 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,928,300 (GRCm39) missense probably damaging 1.00
Z1177:Dnah9 UTSW 11 66,017,476 (GRCm39) missense probably damaging 1.00
Z1186:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1186:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1187:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1187:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1188:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1188:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1189:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1189:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1190:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1190:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1191:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1191:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1192:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1192:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGGCAGAGATCCTCCCTTAGAAAC -3'
(R):5'- AAAGCAGTGTTCTTCCCAGCCTC -3'

Sequencing Primer
(F):5'- TGGAATGACTGTCAACTGCC -3'
(R):5'- AGCCTCTCACTGTCATCTTG -3'
Posted On 2014-08-22