Incidental Mutation 'R0726:Fam20a'
ID 218880
Institutional Source Beutler Lab
Gene Symbol Fam20a
Ensembl Gene ENSMUSG00000020614
Gene Name FAM20A, golgi associated secretory pathway pseudokinase
Synonyms
MMRRC Submission 038908-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0726 (G1)
Quality Score 73
Status Validated
Chromosome 11
Chromosomal Location 109563752-109613989 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 109568020 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 357 (N357Y)
Ref Sequence ENSEMBL: ENSMUSP00000116687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020938] [ENSMUST00000155559]
AlphaFold Q8CID3
Predicted Effect probably damaging
Transcript: ENSMUST00000020938
AA Change: N357Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020938
Gene: ENSMUSG00000020614
AA Change: N357Y

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
Pfam:Fam20C 306 522 8.9e-101 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146408
Predicted Effect probably damaging
Transcript: ENSMUST00000155559
AA Change: N357Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116687
Gene: ENSMUSG00000020614
AA Change: N357Y

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
low complexity region 50 61 N/A INTRINSIC
Pfam:DUF1193 305 525 3.2e-103 PFAM
Meta Mutation Damage Score 0.3882 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 89.2%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a protein that is likely secreted and may function in hematopoiesis. A mutation at this locus has been associated with amelogenesis imperfecta and gingival hyperplasia syndrome. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal ameloblast morphology, disrupted dental enamel formation in both incisor and molar teeth, abnormal kidney morphology, disseminated calcifications of muscular arteries, and intrapulmonary calcifications. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acte1 A G 7: 143,425,498 (GRCm39) D49G probably damaging Het
Alg12 T C 15: 88,690,850 (GRCm39) Y256C probably damaging Het
Alox15 T A 11: 70,241,021 (GRCm39) D160V probably damaging Het
Aox1 T C 1: 58,373,941 (GRCm39) probably benign Het
Bbs9 G T 9: 22,705,119 (GRCm39) A729S probably damaging Het
Bltp3a T C 17: 28,104,463 (GRCm39) V503A possibly damaging Het
Bmp2k T A 5: 97,235,353 (GRCm39) probably benign Het
Braf C T 6: 39,639,082 (GRCm39) R223Q possibly damaging Het
Cd101 A T 3: 100,927,938 (GRCm39) S48T possibly damaging Het
Cdh9 T G 15: 16,831,130 (GRCm39) D322E probably benign Het
Col28a1 C T 6: 8,014,495 (GRCm39) probably null Het
Cpxm1 G A 2: 130,232,859 (GRCm39) R712W probably damaging Het
Csnk1g1 T C 9: 65,939,637 (GRCm39) probably benign Het
Cyp2d37-ps A C 15: 82,574,650 (GRCm39) noncoding transcript Het
Cyth3 T C 5: 143,678,397 (GRCm39) V115A probably benign Het
Dnah9 C T 11: 65,856,507 (GRCm39) V2885M probably damaging Het
Dock9 G T 14: 121,889,180 (GRCm39) Y326* probably null Het
Espl1 T C 15: 102,231,033 (GRCm39) I1844T probably benign Het
Fancc C A 13: 63,471,225 (GRCm39) R385L probably benign Het
Foxe3 A T 4: 114,782,447 (GRCm39) L255H unknown Het
Frem2 T C 3: 53,427,047 (GRCm39) D2967G possibly damaging Het
Gabra6 T G 11: 42,205,954 (GRCm39) T301P probably damaging Het
Ganab T A 19: 8,888,477 (GRCm39) Y511N probably damaging Het
Grm4 T A 17: 27,657,412 (GRCm39) probably benign Het
H1f6 G T 13: 23,880,307 (GRCm39) K153N possibly damaging Het
Kcnj9 G A 1: 172,153,488 (GRCm39) S212F probably damaging Het
Kif15 C A 9: 122,788,993 (GRCm39) H62N probably benign Het
Kptn A G 7: 15,854,647 (GRCm39) D106G probably damaging Het
Krtap13-1 T A 16: 88,526,192 (GRCm39) S139T probably damaging Het
Lepr C A 4: 101,622,131 (GRCm39) N354K probably benign Het
Lypd3 G T 7: 24,337,969 (GRCm39) E112* probably null Het
Med13l A T 5: 118,886,749 (GRCm39) N1550I probably damaging Het
Mettl2 C T 11: 105,017,670 (GRCm39) P60L probably benign Het
Mtcl2 G T 2: 156,902,182 (GRCm39) R278S probably damaging Het
Muc4 A G 16: 32,590,201 (GRCm39) E850G probably damaging Het
Mylk G C 16: 34,699,845 (GRCm39) E403Q possibly damaging Het
Nek1 A G 8: 61,542,626 (GRCm39) R739G probably damaging Het
Nipbl A T 15: 8,381,039 (GRCm39) D584E probably benign Het
Nkain3 C T 4: 20,158,388 (GRCm39) V162M possibly damaging Het
Nmrk1 T C 19: 18,618,844 (GRCm39) probably benign Het
Nsd2 T C 5: 34,018,372 (GRCm39) probably benign Het
Or2n1b T C 17: 38,459,515 (GRCm39) F12S probably damaging Het
Or4b1 T A 2: 89,979,627 (GRCm39) H241L probably damaging Het
Or4p23 A T 2: 88,576,352 (GRCm39) N293K probably benign Het
Or5b24 T A 19: 12,912,969 (GRCm39) V289D probably damaging Het
Or8b44 T A 9: 38,410,418 (GRCm39) M151K possibly damaging Het
Otulinl A T 15: 27,657,033 (GRCm39) I338N probably damaging Het
Phex T A X: 156,155,557 (GRCm39) probably benign Het
Pip5k1b G T 19: 24,356,256 (GRCm39) D227E probably damaging Het
Prdm13 A G 4: 21,683,914 (GRCm39) I119T unknown Het
Rab19 G T 6: 39,360,893 (GRCm39) V14L probably benign Het
Rasa3 A G 8: 13,630,118 (GRCm39) probably benign Het
Rgsl1 C T 1: 153,678,074 (GRCm39) S118N probably damaging Het
Rif1 C T 2: 52,000,365 (GRCm39) T1273M possibly damaging Het
Scn8a A G 15: 100,870,711 (GRCm39) N254S probably damaging Het
Sema6a T C 18: 47,425,048 (GRCm39) T188A probably damaging Het
Sh3pxd2a C T 19: 47,257,201 (GRCm39) E506K probably damaging Het
Smarca2 A T 19: 26,675,803 (GRCm39) K1014N probably damaging Het
Smarca4 T G 9: 21,611,435 (GRCm39) probably null Het
Sntb1 T C 15: 55,539,752 (GRCm39) R361G probably benign Het
Stx5a T A 19: 8,732,275 (GRCm39) I208N probably damaging Het
Tas2r102 T A 6: 132,739,415 (GRCm39) W108R probably damaging Het
Tcl1 A G 12: 105,184,929 (GRCm39) Y94H probably damaging Het
Tenm3 T A 8: 48,689,629 (GRCm39) Y1986F probably damaging Het
Tet2 G A 3: 133,173,945 (GRCm39) P1439L probably benign Het
Tiam2 T C 17: 3,563,108 (GRCm39) probably benign Het
Ubap2l G A 3: 89,928,553 (GRCm39) T526M probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Ushbp1 T A 8: 71,841,391 (GRCm39) probably benign Het
Usp28 C T 9: 48,915,169 (GRCm39) R115C probably damaging Het
Vldlr A T 19: 27,215,786 (GRCm39) D261V probably damaging Het
Vmn2r5 C T 3: 64,411,186 (GRCm39) D461N probably benign Het
Vmn2r86 A T 10: 130,282,265 (GRCm39) F784I probably damaging Het
Zfp59 A T 7: 27,553,513 (GRCm39) I322F probably damaging Het
Zfp607a A T 7: 27,578,574 (GRCm39) H548L probably benign Het
Zfp626 G A 7: 27,518,048 (GRCm39) C343Y probably damaging Het
Other mutations in Fam20a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Fam20a APN 11 109,568,588 (GRCm39) splice site probably benign
IGL01296:Fam20a APN 11 109,576,177 (GRCm39) missense possibly damaging 0.93
IGL01319:Fam20a APN 11 109,569,284 (GRCm39) splice site probably benign
IGL01322:Fam20a APN 11 109,573,738 (GRCm39) missense probably damaging 1.00
IGL02086:Fam20a APN 11 109,564,239 (GRCm39) missense probably benign 0.00
IGL02563:Fam20a APN 11 109,568,620 (GRCm39) missense possibly damaging 0.53
IGL02883:Fam20a APN 11 109,565,953 (GRCm39) missense probably damaging 0.99
IGL02893:Fam20a APN 11 109,612,414 (GRCm39) missense probably benign 0.00
Infamy UTSW 11 109,564,168 (GRCm39) missense possibly damaging 0.87
snide UTSW 11 109,612,201 (GRCm39) missense possibly damaging 0.92
ungainly UTSW 11 109,573,696 (GRCm39) nonsense probably null
P0026:Fam20a UTSW 11 109,566,667 (GRCm39) critical splice donor site probably null
R1317:Fam20a UTSW 11 109,568,664 (GRCm39) missense probably damaging 0.99
R1462:Fam20a UTSW 11 109,568,143 (GRCm39) missense probably damaging 1.00
R1462:Fam20a UTSW 11 109,568,143 (GRCm39) missense probably damaging 1.00
R1751:Fam20a UTSW 11 109,568,664 (GRCm39) missense probably damaging 0.99
R1761:Fam20a UTSW 11 109,568,664 (GRCm39) missense probably damaging 0.99
R1889:Fam20a UTSW 11 109,564,380 (GRCm39) missense probably benign 0.30
R1895:Fam20a UTSW 11 109,564,380 (GRCm39) missense probably benign 0.30
R1971:Fam20a UTSW 11 109,576,237 (GRCm39) missense probably damaging 1.00
R2192:Fam20a UTSW 11 109,565,449 (GRCm39) missense probably benign 0.13
R3745:Fam20a UTSW 11 109,568,616 (GRCm39) missense probably benign 0.17
R4684:Fam20a UTSW 11 109,612,513 (GRCm39) missense unknown
R4835:Fam20a UTSW 11 109,564,389 (GRCm39) missense probably benign 0.40
R5045:Fam20a UTSW 11 109,568,711 (GRCm39) missense probably benign 0.38
R5161:Fam20a UTSW 11 109,564,196 (GRCm39) missense probably benign 0.00
R5715:Fam20a UTSW 11 109,569,257 (GRCm39) missense probably damaging 1.00
R5817:Fam20a UTSW 11 109,564,244 (GRCm39) missense possibly damaging 0.81
R5960:Fam20a UTSW 11 109,566,795 (GRCm39) intron probably benign
R6162:Fam20a UTSW 11 109,573,696 (GRCm39) nonsense probably null
R6312:Fam20a UTSW 11 109,565,456 (GRCm39) missense probably damaging 1.00
R7231:Fam20a UTSW 11 109,612,201 (GRCm39) missense possibly damaging 0.92
R7311:Fam20a UTSW 11 109,565,454 (GRCm39) nonsense probably null
R7366:Fam20a UTSW 11 109,564,168 (GRCm39) missense possibly damaging 0.87
R8013:Fam20a UTSW 11 109,576,332 (GRCm39) missense possibly damaging 0.92
R8014:Fam20a UTSW 11 109,576,332 (GRCm39) missense possibly damaging 0.92
R9086:Fam20a UTSW 11 109,566,754 (GRCm39) nonsense probably null
R9751:Fam20a UTSW 11 109,565,992 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAGTGCAGCCACCCTGAAGAGC -3'
(R):5'- GCAGAAGATGACAGCCCTATCAAGC -3'

Sequencing Primer
(F):5'- ACCCTGAAGAGCTGGGC -3'
(R):5'- CCTATCAAGCCCCCACTTTAC -3'
Posted On 2014-08-22