Incidental Mutation 'R0726:Or2n1b'
ID 218886
Institutional Source Beutler Lab
Gene Symbol Or2n1b
Ensembl Gene ENSMUSG00000063240
Gene Name olfactory receptor family 2 subfamily N member 1B
Synonyms GA_x6K02T2PSCP-2597192-2598130, MOR256-6, Olfr133
MMRRC Submission 038908-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.246) question?
Stock # R0726 (G1)
Quality Score 73
Status Validated
Chromosome 17
Chromosomal Location 38459481-38460419 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38459515 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 12 (F12S)
Ref Sequence ENSEMBL: ENSMUSP00000150597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113636] [ENSMUST00000173610] [ENSMUST00000215078] [ENSMUST00000215549]
AlphaFold Q8VG94
Predicted Effect probably damaging
Transcript: ENSMUST00000113636
AA Change: F12S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109266
Gene: ENSMUSG00000063240
AA Change: F12S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 27 305 3.4e-7 PFAM
Pfam:7tm_4 31 308 6.1e-52 PFAM
Pfam:7tm_1 41 290 1.5e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173610
AA Change: F12S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133824
Gene: ENSMUSG00000063240
AA Change: F12S

DomainStartEndE-ValueType
Pfam:7tm_1 55 109 3.3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215078
AA Change: F12S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215549
AA Change: F12S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 89.2%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acte1 A G 7: 143,425,498 (GRCm39) D49G probably damaging Het
Alg12 T C 15: 88,690,850 (GRCm39) Y256C probably damaging Het
Alox15 T A 11: 70,241,021 (GRCm39) D160V probably damaging Het
Aox1 T C 1: 58,373,941 (GRCm39) probably benign Het
Bbs9 G T 9: 22,705,119 (GRCm39) A729S probably damaging Het
Bltp3a T C 17: 28,104,463 (GRCm39) V503A possibly damaging Het
Bmp2k T A 5: 97,235,353 (GRCm39) probably benign Het
Braf C T 6: 39,639,082 (GRCm39) R223Q possibly damaging Het
Cd101 A T 3: 100,927,938 (GRCm39) S48T possibly damaging Het
Cdh9 T G 15: 16,831,130 (GRCm39) D322E probably benign Het
Col28a1 C T 6: 8,014,495 (GRCm39) probably null Het
Cpxm1 G A 2: 130,232,859 (GRCm39) R712W probably damaging Het
Csnk1g1 T C 9: 65,939,637 (GRCm39) probably benign Het
Cyp2d37-ps A C 15: 82,574,650 (GRCm39) noncoding transcript Het
Cyth3 T C 5: 143,678,397 (GRCm39) V115A probably benign Het
Dnah9 C T 11: 65,856,507 (GRCm39) V2885M probably damaging Het
Dock9 G T 14: 121,889,180 (GRCm39) Y326* probably null Het
Espl1 T C 15: 102,231,033 (GRCm39) I1844T probably benign Het
Fam20a T A 11: 109,568,020 (GRCm39) N357Y probably damaging Het
Fancc C A 13: 63,471,225 (GRCm39) R385L probably benign Het
Foxe3 A T 4: 114,782,447 (GRCm39) L255H unknown Het
Frem2 T C 3: 53,427,047 (GRCm39) D2967G possibly damaging Het
Gabra6 T G 11: 42,205,954 (GRCm39) T301P probably damaging Het
Ganab T A 19: 8,888,477 (GRCm39) Y511N probably damaging Het
Grm4 T A 17: 27,657,412 (GRCm39) probably benign Het
H1f6 G T 13: 23,880,307 (GRCm39) K153N possibly damaging Het
Kcnj9 G A 1: 172,153,488 (GRCm39) S212F probably damaging Het
Kif15 C A 9: 122,788,993 (GRCm39) H62N probably benign Het
Kptn A G 7: 15,854,647 (GRCm39) D106G probably damaging Het
Krtap13-1 T A 16: 88,526,192 (GRCm39) S139T probably damaging Het
Lepr C A 4: 101,622,131 (GRCm39) N354K probably benign Het
Lypd3 G T 7: 24,337,969 (GRCm39) E112* probably null Het
Med13l A T 5: 118,886,749 (GRCm39) N1550I probably damaging Het
Mettl2 C T 11: 105,017,670 (GRCm39) P60L probably benign Het
Mtcl2 G T 2: 156,902,182 (GRCm39) R278S probably damaging Het
Muc4 A G 16: 32,590,201 (GRCm39) E850G probably damaging Het
Mylk G C 16: 34,699,845 (GRCm39) E403Q possibly damaging Het
Nek1 A G 8: 61,542,626 (GRCm39) R739G probably damaging Het
Nipbl A T 15: 8,381,039 (GRCm39) D584E probably benign Het
Nkain3 C T 4: 20,158,388 (GRCm39) V162M possibly damaging Het
Nmrk1 T C 19: 18,618,844 (GRCm39) probably benign Het
Nsd2 T C 5: 34,018,372 (GRCm39) probably benign Het
Or4b1 T A 2: 89,979,627 (GRCm39) H241L probably damaging Het
Or4p23 A T 2: 88,576,352 (GRCm39) N293K probably benign Het
Or5b24 T A 19: 12,912,969 (GRCm39) V289D probably damaging Het
Or8b44 T A 9: 38,410,418 (GRCm39) M151K possibly damaging Het
Otulinl A T 15: 27,657,033 (GRCm39) I338N probably damaging Het
Phex T A X: 156,155,557 (GRCm39) probably benign Het
Pip5k1b G T 19: 24,356,256 (GRCm39) D227E probably damaging Het
Prdm13 A G 4: 21,683,914 (GRCm39) I119T unknown Het
Rab19 G T 6: 39,360,893 (GRCm39) V14L probably benign Het
Rasa3 A G 8: 13,630,118 (GRCm39) probably benign Het
Rgsl1 C T 1: 153,678,074 (GRCm39) S118N probably damaging Het
Rif1 C T 2: 52,000,365 (GRCm39) T1273M possibly damaging Het
Scn8a A G 15: 100,870,711 (GRCm39) N254S probably damaging Het
Sema6a T C 18: 47,425,048 (GRCm39) T188A probably damaging Het
Sh3pxd2a C T 19: 47,257,201 (GRCm39) E506K probably damaging Het
Smarca2 A T 19: 26,675,803 (GRCm39) K1014N probably damaging Het
Smarca4 T G 9: 21,611,435 (GRCm39) probably null Het
Sntb1 T C 15: 55,539,752 (GRCm39) R361G probably benign Het
Stx5a T A 19: 8,732,275 (GRCm39) I208N probably damaging Het
Tas2r102 T A 6: 132,739,415 (GRCm39) W108R probably damaging Het
Tcl1 A G 12: 105,184,929 (GRCm39) Y94H probably damaging Het
Tenm3 T A 8: 48,689,629 (GRCm39) Y1986F probably damaging Het
Tet2 G A 3: 133,173,945 (GRCm39) P1439L probably benign Het
Tiam2 T C 17: 3,563,108 (GRCm39) probably benign Het
Ubap2l G A 3: 89,928,553 (GRCm39) T526M probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Ushbp1 T A 8: 71,841,391 (GRCm39) probably benign Het
Usp28 C T 9: 48,915,169 (GRCm39) R115C probably damaging Het
Vldlr A T 19: 27,215,786 (GRCm39) D261V probably damaging Het
Vmn2r5 C T 3: 64,411,186 (GRCm39) D461N probably benign Het
Vmn2r86 A T 10: 130,282,265 (GRCm39) F784I probably damaging Het
Zfp59 A T 7: 27,553,513 (GRCm39) I322F probably damaging Het
Zfp607a A T 7: 27,578,574 (GRCm39) H548L probably benign Het
Zfp626 G A 7: 27,518,048 (GRCm39) C343Y probably damaging Het
Other mutations in Or2n1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02212:Or2n1b APN 17 38,459,746 (GRCm39) missense probably benign
IGL02486:Or2n1b APN 17 38,460,112 (GRCm39) missense probably damaging 1.00
IGL02574:Or2n1b APN 17 38,460,280 (GRCm39) missense possibly damaging 0.56
PIT4243001:Or2n1b UTSW 17 38,460,394 (GRCm39) missense probably benign 0.06
PIT4504001:Or2n1b UTSW 17 38,460,060 (GRCm39) missense probably benign
R2242:Or2n1b UTSW 17 38,459,613 (GRCm39) missense possibly damaging 0.87
R2496:Or2n1b UTSW 17 38,460,322 (GRCm39) missense possibly damaging 0.91
R4579:Or2n1b UTSW 17 38,460,296 (GRCm39) missense probably damaging 1.00
R5085:Or2n1b UTSW 17 38,460,003 (GRCm39) missense probably damaging 1.00
R6273:Or2n1b UTSW 17 38,459,833 (GRCm39) missense possibly damaging 0.94
R6344:Or2n1b UTSW 17 38,459,611 (GRCm39) missense probably benign 0.01
R7046:Or2n1b UTSW 17 38,459,691 (GRCm39) missense probably benign 0.00
R7090:Or2n1b UTSW 17 38,460,385 (GRCm39) missense probably benign 0.33
R7213:Or2n1b UTSW 17 38,459,965 (GRCm39) missense probably benign 0.00
R8874:Or2n1b UTSW 17 38,459,623 (GRCm39) missense possibly damaging 0.78
R9185:Or2n1b UTSW 17 38,459,754 (GRCm39) missense probably damaging 1.00
R9334:Or2n1b UTSW 17 38,459,840 (GRCm39) missense probably benign 0.01
R9703:Or2n1b UTSW 17 38,459,856 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CACGATGGCATTTCAAGCGTGG -3'
(R):5'- TGGACACTAACAGGACACAGTTGC -3'

Sequencing Primer
(F):5'- CAAGCGTGGAATGCTAATCTTGG -3'
(R):5'- ACACCTCATGTAGCTGATGG -3'
Posted On 2014-08-22