Mutagenetix > Incidental Mutations

Incidental Mutation 'R0731:Kifc3'

218894

Institutional Source

Beutler Lab

Gene Symbol

Kifc3

Ensembl Gene

ENSMUSG00000031788

Gene Name

kinesin family member C3

Synonyms

MMRRC Submission

038912-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0731 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

95099828-95202812 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 95105733 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 487 (T487I)

Ref Sequence

ENSEMBL: ENSMUSP00000126784 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034240] [ENSMUST00000169353] [ENSMUST00000169748] [ENSMUST00000212424] [ENSMUST00000212787] [ENSMUST00000212968] [ENSMUST00000213004]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034240
AA Change: T533I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034240
Gene: ENSMUSG00000031788
AA Change: T533I

Domain	Start	End	E-Value	Type
low complexity region	33	46	N/A	INTRINSIC
coiled coil region	100	360	N/A	INTRINSIC
coiled coil region	393	430	N/A	INTRINSIC
KISc	441	774	3.15e-158	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000169353
AA Change: T418I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000127427
Gene: ENSMUSG00000031788
AA Change: T418I

Domain	Start	End	E-Value	Type
coiled coil region	33	223	N/A	INTRINSIC
coiled coil region	256	293	N/A	INTRINSIC
KISc	304	637	3.15e-158	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000169748
AA Change: T487I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126784
Gene: ENSMUSG00000031788
AA Change: T487I

Domain	Start	End	E-Value	Type
coiled coil region	34	324	N/A	INTRINSIC
coiled coil region	357	394	N/A	INTRINSIC
KISc	405	728	3.11e-148	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211854

Predicted Effect

probably benign
Transcript: ENSMUST00000212424

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212656

Predicted Effect

probably benign
Transcript: ENSMUST00000212787

Predicted Effect

probably benign
Transcript: ENSMUST00000212968

Predicted Effect

probably damaging
Transcript: ENSMUST00000213004
AA Change: T396I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.5%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin-14 family of microtubule motors. Members of this family play a role in the formation, maintenance and remodeling of the bipolar mitotic spindle. The protein encoded by this gene has cytoplasmic functions in the interphase cells. It may also be involved in the final stages of cytokinesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for this targeted mutation are viable, fertile, and appear phenotypically indistinguishable from wild-type littermates. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430F08Rik	T	C	10: 100,586,203	T66A	probably damaging	Het
4933406M09Rik	A	C	1: 134,389,975	M162L	probably benign	Het
Acsm3	A	T	7: 119,768,024	R27*	probably null	Het
Actg1	A	G	11: 120,346,949	F255S	probably damaging	Het
Ahdc1	T	A	4: 133,062,951	V501E	possibly damaging	Het
Alpk2	A	T	18: 65,305,390	D1444E	probably damaging	Het
Btaf1	T	G	19: 36,997,495		probably null	Het
Cacnb2	A	G	2: 14,985,706	H489R	possibly damaging	Het
Ccdc162	C	A	10: 41,579,143	K398N	probably damaging	Het
Cd79b	G	T	11: 106,312,433	S145R	probably damaging	Het
Cdh11	T	A	8: 102,668,019	N264Y	probably damaging	Het
Celsr1	T	C	15: 85,901,597	D2892G	probably benign	Het
Chuk	A	G	19: 44,103,766		probably benign	Het
Clk3	T	C	9: 57,751,126		probably benign	Het
Dcaf8	A	T	1: 172,172,509	D78V	possibly damaging	Het
Dctn1	A	G	6: 83,183,089	T87A	probably damaging	Het
Ddx50	T	C	10: 62,616,249	N732D	unknown	Het
Dnah5	A	T	15: 28,311,143	Y1756F	possibly damaging	Het
Dock3	A	T	9: 106,969,856	V858E	probably damaging	Het
Fer1l4	A	G	2: 156,024,070	F1566S	probably benign	Het
Fpr-rs7	T	C	17: 20,113,854	I125V	probably benign	Het
Fuca2	C	T	10: 13,506,027	P228L	probably benign	Het
Galntl6	A	G	8: 58,535,984	F57L	probably benign	Het
Gigyf2	T	A	1: 87,407,727		probably benign	Het
Gm16505	A	T	13: 3,361,329		noncoding transcript	Het
Gm4781	T	C	10: 100,396,777		noncoding transcript	Het
Gm9956	T	A	10: 56,745,543	Y100*	probably null	Het
Gpr137c	T	A	14: 45,246,349	C178S	probably damaging	Het
Gpr83	A	G	9: 14,868,644	R331G	probably benign	Het
Hlcs	T	A	16: 94,131,852	H851L	probably damaging	Het
Kbtbd6	C	A	14: 79,451,884	Y6*	probably null	Het
Kif23	T	C	9: 61,925,032	R610G	possibly damaging	Het
Klra5	A	C	6: 129,908,796	D133E	possibly damaging	Het
Klra6	T	C	6: 130,022,705	E100G	probably damaging	Het
Klre1	T	A	6: 129,585,568		probably benign	Het
Lancl1	C	T	1: 67,009,910		probably null	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Man1b1	A	G	2: 25,338,155	I146V	possibly damaging	Het
Map4k5	T	A	12: 69,874,264		probably benign	Het
Mast3	A	G	8: 70,781,321	S178P	probably damaging	Het
Mau2	A	G	8: 70,023,612		probably null	Het
Mkrn2	A	T	6: 115,614,651	N312Y	probably damaging	Het
Mrvi1	T	C	7: 110,876,900	S615G	probably benign	Het
Myh1	A	G	11: 67,202,533	E150G	probably damaging	Het
Myo7b	T	A	18: 31,961,825		probably null	Het
Nyap1	A	G	5: 137,735,298	V491A	probably damaging	Het
Olfr1284	A	G	2: 111,379,293	M98V	probably damaging	Het
Olfr484	T	C	7: 108,124,734	I176M	probably benign	Het
Olfr518	A	T	7: 108,881,533	N24K	probably damaging	Het
Olfr954	T	C	9: 39,461,532	F34L	probably damaging	Het
Oxsm	A	T	14: 16,240,893	H385Q	probably damaging	Het
Pbld2	T	C	10: 63,056,811	S242P	probably damaging	Het
Pdzd7	T	C	19: 45,029,305	Y675C	probably damaging	Het
Pnkd	T	A	1: 74,351,541	H266Q	probably damaging	Het
Rbfox2	A	G	15: 77,099,279	S141P	probably benign	Het
Rdx	A	G	9: 52,068,218	T214A	probably benign	Het
Ripor2	A	T	13: 24,680,644	E219V	probably damaging	Het
Rufy2	G	A	10: 63,011,844		probably benign	Het
Slf2	T	A	19: 44,975,726		probably benign	Het
Snrnp200	G	T	2: 127,226,145		probably benign	Het
Snx7	T	A	3: 117,829,671		probably benign	Het
Stt3a	T	C	9: 36,735,512	I602V	probably damaging	Het
Tacr3	G	A	3: 134,855,000		probably null	Het
Tcerg1	C	T	18: 42,571,840	T978M	probably damaging	Het
Tcf7l1	G	T	6: 72,788,269	P126Q	possibly damaging	Het
Trank1	A	G	9: 111,365,488	D860G	probably damaging	Het
Try4	T	C	6: 41,304,367	L81P	probably benign	Het
Ucp1	T	C	8: 83,297,847		probably benign	Het
Ugt2b38	G	A	5: 87,420,452	A328V	probably damaging	Het
Wfikkn1	T	A	17: 25,878,017	R444S	probably damaging	Het
Zfc3h1	A	G	10: 115,410,632	T875A	probably benign	Het
Zfp11	A	G	5: 129,657,264	S378P	probably damaging	Het
Zfp984	T	A	4: 147,756,232	N54I	probably damaging	Het

Other mutations in Kifc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00720:Kifc3	APN	8	95138016	missense	probably damaging	1.00
IGL01904:Kifc3	APN	8	95137957	missense	possibly damaging	0.81
IGL02019:Kifc3	APN	8	95107540	splice site	probably benign
IGL02090:Kifc3	APN	8	95102480	missense	probably damaging	1.00
IGL02355:Kifc3	APN	8	95109879	missense	probably damaging	1.00
IGL02362:Kifc3	APN	8	95109879	missense	probably damaging	1.00
IGL02620:Kifc3	APN	8	95109954	missense	probably damaging	0.98
IGL02720:Kifc3	APN	8	95108365	missense	probably benign	0.00
IGL03030:Kifc3	APN	8	95102412	missense	probably damaging	1.00
IGL03327:Kifc3	APN	8	95108432	missense	probably damaging	1.00
IGL03390:Kifc3	APN	8	95108613	missense	probably damaging	1.00
R0233:Kifc3	UTSW	8	95101472	splice site	probably null
R0281:Kifc3	UTSW	8	95103460	missense	probably damaging	1.00
R0302:Kifc3	UTSW	8	95103470	missense	possibly damaging	0.50
R0619:Kifc3	UTSW	8	95102665	missense	probably benign	0.13
R1017:Kifc3	UTSW	8	95105785	missense	probably damaging	0.99
R1147:Kifc3	UTSW	8	95137918	missense	probably damaging	1.00
R1147:Kifc3	UTSW	8	95137918	missense	probably damaging	1.00
R1257:Kifc3	UTSW	8	95105772	missense	probably damaging	0.98
R1472:Kifc3	UTSW	8	95137913	critical splice donor site	probably null
R1480:Kifc3	UTSW	8	95109887	missense	probably damaging	1.00
R1553:Kifc3	UTSW	8	95106542	missense	possibly damaging	0.67
R2071:Kifc3	UTSW	8	95108353	critical splice donor site	probably null
R2115:Kifc3	UTSW	8	95108713	missense	probably damaging	1.00
R3703:Kifc3	UTSW	8	95104028	splice site	probably benign
R3704:Kifc3	UTSW	8	95104028	splice site	probably benign
R3705:Kifc3	UTSW	8	95104028	splice site	probably benign
R4223:Kifc3	UTSW	8	95109982	missense	probably damaging	0.96
R4463:Kifc3	UTSW	8	95102116	missense	probably damaging	1.00
R4508:Kifc3	UTSW	8	95107420	splice site	probably null
R4980:Kifc3	UTSW	8	95126549	missense	probably benign
R5032:Kifc3	UTSW	8	95102726	missense	probably damaging	1.00
R5068:Kifc3	UTSW	8	95110216	missense	possibly damaging	0.54
R5421:Kifc3	UTSW	8	95109845	missense	probably damaging	0.99
R5556:Kifc3	UTSW	8	95108459	nonsense	probably null
R6845:Kifc3	UTSW	8	95108679	missense	probably benign	0.28
R7136:Kifc3	UTSW	8	95103449	missense	probably benign	0.10
R7196:Kifc3	UTSW	8	95106611	missense	probably benign	0.02
R7404:Kifc3	UTSW	8	95103464	missense	probably benign	0.02
R7441:Kifc3	UTSW	8	95137987	missense	probably benign	0.00
R7784:Kifc3	UTSW	8	95110692	critical splice donor site	probably null
R7861:Kifc3	UTSW	8	95107537	critical splice acceptor site	probably null
R8440:Kifc3	UTSW	8	95109794	missense	possibly damaging	0.89
R8754:Kifc3	UTSW	8	95102396	missense	probably damaging	1.00
R8983:Kifc3	UTSW	8	95106476	missense	probably damaging	1.00
R9035:Kifc3	UTSW	8	95126567	missense	possibly damaging	0.52
X0023:Kifc3	UTSW	8	95109298	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTTAGCGTGTGAAGACTTGGTCCC -3'
(R):5'- ATGGTCCAGGCACATACTCTCCTC -3'

Sequencing Primer
(F):5'- AAGACTTGGTCCCTGGGAG -3'
(R):5'- GTCAAGCCTTCCCTGAGAATG -3'

Posted On

2014-08-22