Mutagenetix > Incidental Mutation

Incidental Mutation 'R1966:Plxna2'

218907

Institutional Source

Beutler Lab

Gene Symbol

Plxna2

Ensembl Gene

ENSMUSG00000026640

Gene Name

plexin A2

Synonyms

2810428A13Rik, OCT, PlexA2, Plxn2

MMRRC Submission

039979-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1966 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

194618218-194816869 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 194644700 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 314 (Y314F)

Ref Sequence

ENSEMBL: ENSMUSP00000027952 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027952]

AlphaFold

P70207

PDB Structure

Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027952
AA Change: Y314F

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: Y314F

Domain	Start	End	E-Value	Type
low complexity region	16	29	N/A	INTRINSIC
Sema	50	492	1.65e-132	SMART
PSI	510	560	8e-12	SMART
PSI	655	702	6.35e-6	SMART
PSI	803	856	1.24e-8	SMART
IPT	857	952	6.36e-21	SMART
IPT	953	1038	1.02e-24	SMART
IPT	1040	1140	1.48e-21	SMART
IPT	1142	1237	8.81e-6	SMART
transmembrane domain	1238	1260	N/A	INTRINSIC
Pfam:Plexin_cytopl	1311	1864	1.9e-261	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125381

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810013L24Rik	A	G	16: 8,830,581	E41G	possibly damaging	Het
2410002F23Rik	T	A	7: 44,251,226	V185E	probably benign	Het
Abca1	A	C	4: 53,050,409	V1608G	probably damaging	Het
Ap2b1	T	C	11: 83,346,895	I557T	probably benign	Het
Arhgef15	G	T	11: 68,954,675	P117Q	probably damaging	Het
Arhgef39	T	C	4: 43,496,710	S335G	probably benign	Het
Blm	A	T	7: 80,513,186	F139Y	possibly damaging	Het
Cacna2d1	C	T	5: 16,333,785	R581*	probably null	Het
Cadps	C	A	14: 12,822,450	E97*	probably null	Het
Cavin2	T	A	1: 51,289,642	L86Q	probably damaging	Het
Ccdc136	A	G	6: 29,418,092	E787G	probably damaging	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Cdh23	T	C	10: 60,323,582	Y2138C	probably damaging	Het
Cdk12	T	A	11: 98,204,090	Y241*	probably null	Het
Clcn4	T	A	7: 7,284,185	*688L	probably null	Het
Cntnap1	T	C	11: 101,180,386	V375A	possibly damaging	Het
Coq5	T	A	5: 115,294,831		probably null	Het
Cyp4b1	A	G	4: 115,625,879	I405T	probably benign	Het
Det1	T	C	7: 78,843,218	Y346C	probably damaging	Het
Enpp3	A	T	10: 24,807,491	V276E	probably damaging	Het
Epb41l2	G	A	10: 25,441,768	R61Q	probably benign	Het
Fam76b	G	A	9: 13,828,066		probably null	Het
Fbxo45	A	T	16: 32,233,230	D238E	probably benign	Het
Fnip2	G	A	3: 79,493,472	T314I	probably benign	Het
Fsip2	T	C	2: 82,992,780	S6286P	possibly damaging	Het
Gbf1	T	C	19: 46,271,564	F999L	probably damaging	Het
Gm14139	T	A	2: 150,191,907	D49E	probably benign	Het
Gnao1	C	A	8: 93,944,199	T102K	probably benign	Het
Gpatch2	T	A	1: 187,322,301	D76E	probably damaging	Het
Gpd1l	A	G	9: 114,914,394	I146T	probably benign	Het
Grik2	A	T	10: 49,355,909	H508Q	probably damaging	Het
Hk3	A	T	13: 55,014,455	F112Y	probably damaging	Het
Hmcn2	T	G	2: 31,389,329	I1781S	probably damaging	Het
Inhba	A	T	13: 16,026,636	K261M	probably damaging	Het
Jarid2	T	A	13: 44,906,276	N661K	probably damaging	Het
Kcna2	T	C	3: 107,104,630	S176P	probably damaging	Het
Kcnj3	A	T	2: 55,437,331	Q44L	probably damaging	Het
Kcns1	G	T	2: 164,168,535	F101L	probably damaging	Het
Kdm5b	T	A	1: 134,613,873		probably null	Het
Klhl14	C	T	18: 21,554,673	G564D	probably damaging	Het
Klhl18	A	T	9: 110,476,590	V2E	probably benign	Het
Klhl6	T	C	16: 19,982,822	E61G	probably damaging	Het
Krt1	T	C	15: 101,848,992	D261G	probably benign	Het
Lama5	C	A	2: 180,188,352	C1896F	probably damaging	Het
Lrba	A	G	3: 86,605,868		probably null	Het
Lrch3	A	G	16: 32,914,385	T82A	possibly damaging	Het
Maml3	C	G	3: 52,104,139	G2A	unknown	Het
Mapkap1	T	A	2: 34,518,679	N34K	probably damaging	Het
Muc13	A	T	16: 33,814,539	I488F	probably damaging	Het
Muc5ac	A	G	7: 141,803,376	D1129G	possibly damaging	Het
Nacc1	A	T	8: 84,676,381	N288K	probably damaging	Het
Nek1	T	G	8: 61,016,296	I129R	probably damaging	Het
Nf1	T	A	11: 79,411,564	S319R	possibly damaging	Het
Nle1	C	T	11: 82,901,788	G432D	probably damaging	Het
Nol4l	A	G	2: 153,529,455	V103A	probably benign	Het
Oca2	A	G	7: 56,414,467	I737V	probably damaging	Het
Olfr1270	T	C	2: 90,149,404	S201G	probably damaging	Het
Olfr231	G	T	1: 174,117,251	S255*	probably null	Het
Olfr346	G	A	2: 36,688,784	V261I	probably benign	Het
Olfr358	A	T	2: 37,004,948	F222Y	possibly damaging	Het
Olfr630	G	T	7: 103,755,168	T139K	probably damaging	Het
Olfr655	A	G	7: 104,596,801	C127R	probably damaging	Het
Olfr750	T	A	14: 51,071,157	I79F	probably damaging	Het
Orc1	T	A	4: 108,612,217	I746N	probably damaging	Het
Pbxip1	A	G	3: 89,445,488	D147G	probably damaging	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Plin5	T	A	17: 56,112,186	D412V	probably damaging	Het
Ppid	A	T	3: 79,602,299	K308*	probably null	Het
Prss38	T	C	11: 59,373,484	Y219C	probably damaging	Het
Ptx3	C	T	3: 66,224,621	R188C	probably damaging	Het
Ralgds	T	A	2: 28,545,875	V504E	probably damaging	Het
Rere	T	C	4: 150,616,873	Y1237H	probably damaging	Het
Rpp30	C	T	19: 36,089,149	S94L	probably damaging	Het
Rrp15	C	T	1: 186,736,205	V205I	possibly damaging	Het
Scpep1	A	G	11: 88,952,414	W73R	probably damaging	Het
Sec23ip	A	G	7: 128,755,353	H376R	probably damaging	Het
Serping1	G	T	2: 84,765,728	T454K	probably damaging	Het
Shtn1	T	G	19: 58,975,038	Y615S	probably benign	Het
Slc20a2	C	A	8: 22,545,537	P184T	probably damaging	Het
Slc22a29	C	A	19: 8,218,408	R89L	probably damaging	Het
Slc2a2	A	G	3: 28,719,485	Q313R	probably damaging	Het
Tas2r122	A	T	6: 132,711,194	Y245*	probably null	Het
Ticrr	C	A	7: 79,694,735	C1449*	probably null	Het
Tmem181a	T	C	17: 6,303,226	V412A	probably benign	Het
Tmtc4	T	A	14: 122,927,599	E616V	probably benign	Het
Tnrc6b	A	G	15: 80,880,439	K714R	probably damaging	Het
Trpm8	T	A	1: 88,332,748		probably null	Het
Ubr2	T	C	17: 46,954,919	T1163A	probably benign	Het
Ubr4	A	G	4: 139,451,244		probably null	Het
Ulk2	A	T	11: 61,819,471		probably null	Het
Ulk4	T	A	9: 121,257,116	M350L	probably benign	Het
Vmn1r185	T	C	7: 26,611,531	E183G	probably benign	Het
Vmn1r76	T	A	7: 11,930,514	I223F	probably damaging	Het
Wdr27	T	C	17: 14,934,599	T19A	possibly damaging	Het
Wdr59	T	G	8: 111,450,903	T973P	possibly damaging	Het
Wnk2	A	G	13: 49,039,011	S664P	probably damaging	Het
Zfp120	A	T	2: 150,117,398	C335S	probably damaging	Het
Zfp30	C	A	7: 29,792,452	Q44K	probably benign	Het
Zfp541	T	C	7: 16,079,071	S550P	probably benign	Het
Zw10	C	A	9: 49,068,833	N421K	probably damaging	Het

Other mutations in Plxna2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Plxna2	APN	1	194644657	missense	probably damaging	1.00
IGL00332:Plxna2	APN	1	194789830	missense	probably damaging	0.98
IGL00392:Plxna2	APN	1	194800568	missense	probably damaging	1.00
IGL00432:Plxna2	APN	1	194644096	missense	probably benign	0.03
IGL00704:Plxna2	APN	1	194751461	missense	probably damaging	0.99
IGL00737:Plxna2	APN	1	194746239	splice site	probably benign
IGL01078:Plxna2	APN	1	194786693	unclassified	probably benign
IGL01354:Plxna2	APN	1	194762435	missense	probably benign	0.02
IGL01432:Plxna2	APN	1	194644318	missense	possibly damaging	0.58
IGL01459:Plxna2	APN	1	194764570	missense	probably benign	0.00
IGL01525:Plxna2	APN	1	194712311	missense	probably benign	0.00
IGL01656:Plxna2	APN	1	194790161	missense	possibly damaging	0.52
IGL01825:Plxna2	APN	1	194788902	missense	probably damaging	0.98
IGL01862:Plxna2	APN	1	194643950	missense	possibly damaging	0.87
IGL01899:Plxna2	APN	1	194751488	missense	probably damaging	1.00
IGL01996:Plxna2	APN	1	194799776	missense	probably damaging	0.99
IGL02123:Plxna2	APN	1	194794383	missense	probably damaging	1.00
IGL02226:Plxna2	APN	1	194644424	missense	probably damaging	1.00
IGL02227:Plxna2	APN	1	194752089	missense	probably damaging	1.00
IGL02415:Plxna2	APN	1	194643964	missense	probably damaging	1.00
IGL02440:Plxna2	APN	1	194746150	missense	probably benign	0.10
IGL02545:Plxna2	APN	1	194786690	unclassified	probably benign
IGL02553:Plxna2	APN	1	194751438	missense	probably benign	0.08
IGL02882:Plxna2	APN	1	194762570	missense	probably damaging	1.00
IGL02946:Plxna2	APN	1	194749309	splice site	probably benign
IGL03062:Plxna2	APN	1	194762550	missense	possibly damaging	0.72
IGL03095:Plxna2	APN	1	194801127	missense	probably damaging	1.00
IGL03293:Plxna2	APN	1	194804945	missense	probably damaging	0.99
G1Funyon:Plxna2	UTSW	1	194790175	missense	probably benign	0.01
PIT4514001:Plxna2	UTSW	1	194794937	missense	probably benign	0.00
R0024:Plxna2	UTSW	1	194643995	missense	possibly damaging	0.57
R0040:Plxna2	UTSW	1	194643896	missense	probably benign	0.13
R0040:Plxna2	UTSW	1	194643896	missense	probably benign	0.13
R0063:Plxna2	UTSW	1	194644939	missense	probably benign	0.00
R0063:Plxna2	UTSW	1	194644939	missense	probably benign	0.00
R0217:Plxna2	UTSW	1	194644598	missense	probably damaging	1.00
R0316:Plxna2	UTSW	1	194644150	missense	probably damaging	1.00
R0440:Plxna2	UTSW	1	194644404	nonsense	probably null
R0505:Plxna2	UTSW	1	194644348	missense	possibly damaging	0.93
R0568:Plxna2	UTSW	1	194751386	missense	probably benign	0.00
R0669:Plxna2	UTSW	1	194788837	missense	probably damaging	0.99
R0674:Plxna2	UTSW	1	194649475	missense	probably benign	0.00
R0885:Plxna2	UTSW	1	194644556	missense	probably benign
R0898:Plxna2	UTSW	1	194797024	missense	probably damaging	1.00
R0940:Plxna2	UTSW	1	194800555	missense	probably benign	0.01
R1061:Plxna2	UTSW	1	194644093	missense	probably damaging	1.00
R1067:Plxna2	UTSW	1	194780510	splice site	probably null
R1222:Plxna2	UTSW	1	194800649	missense	probably damaging	1.00
R1345:Plxna2	UTSW	1	194644486	missense	probably damaging	1.00
R1363:Plxna2	UTSW	1	194804939	nonsense	probably null
R1432:Plxna2	UTSW	1	194767463	missense	probably benign	0.10
R1434:Plxna2	UTSW	1	194751540	splice site	probably benign
R1597:Plxna2	UTSW	1	194749306	splice site	probably benign
R1719:Plxna2	UTSW	1	194644370	missense	possibly damaging	0.93
R1778:Plxna2	UTSW	1	194810970	missense	probably benign	0.01
R1795:Plxna2	UTSW	1	194806303	missense	probably damaging	0.99
R1819:Plxna2	UTSW	1	194790186	missense	probably benign	0.03
R1926:Plxna2	UTSW	1	194762450	missense	probably benign	0.02
R1987:Plxna2	UTSW	1	194643989	missense	probably damaging	1.00
R1988:Plxna2	UTSW	1	194643989	missense	probably damaging	1.00
R2034:Plxna2	UTSW	1	194780594	missense	probably benign	0.00
R2131:Plxna2	UTSW	1	194644750	missense	probably benign	0.01
R2171:Plxna2	UTSW	1	194800617	missense	probably damaging	1.00
R2217:Plxna2	UTSW	1	194797748	missense	probably damaging	1.00
R2311:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2340:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2342:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2423:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2424:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2425:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2842:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R2971:Plxna2	UTSW	1	194797731	missense	probably damaging	1.00
R3236:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R3731:Plxna2	UTSW	1	194788885	missense	probably benign	0.42
R3783:Plxna2	UTSW	1	194807521	missense	probably damaging	1.00
R3784:Plxna2	UTSW	1	194644617	missense	probably benign
R3787:Plxna2	UTSW	1	194643934	missense	probably benign	0.10
R3845:Plxna2	UTSW	1	194793790	missense	probably damaging	0.96
R3927:Plxna2	UTSW	1	194746157	missense	probably benign	0.02
R3930:Plxna2	UTSW	1	194794910	missense	probably benign	0.17
R3964:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R3980:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4067:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4120:Plxna2	UTSW	1	194780627	missense	probably damaging	1.00
R4231:Plxna2	UTSW	1	194644454	missense	probably damaging	1.00
R4257:Plxna2	UTSW	1	194644775	missense	probably damaging	1.00
R4396:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4397:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4418:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4444:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4446:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4482:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4487:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4489:Plxna2	UTSW	1	194749317	missense	probably damaging	1.00
R4571:Plxna2	UTSW	1	194810988	missense	possibly damaging	0.91
R4622:Plxna2	UTSW	1	194812150	missense	probably benign
R4623:Plxna2	UTSW	1	194812150	missense	probably benign
R4684:Plxna2	UTSW	1	194762594	missense	probably benign	0.42
R4688:Plxna2	UTSW	1	194644445	missense	probably damaging	1.00
R4855:Plxna2	UTSW	1	194797732	missense	probably benign	0.39
R4876:Plxna2	UTSW	1	194643775	missense	probably benign	0.02
R5161:Plxna2	UTSW	1	194751404	missense	probably benign
R5207:Plxna2	UTSW	1	194788899	missense	probably benign	0.19
R5479:Plxna2	UTSW	1	194793873	missense	probably benign
R5931:Plxna2	UTSW	1	194810870	missense	probably damaging	1.00
R6026:Plxna2	UTSW	1	194799814	missense	probably damaging	1.00
R6029:Plxna2	UTSW	1	194794427	missense	probably benign	0.00
R6029:Plxna2	UTSW	1	194799575	missense	probably damaging	1.00
R6059:Plxna2	UTSW	1	194810971	missense	possibly damaging	0.79
R6238:Plxna2	UTSW	1	194790196	missense	probably benign	0.01
R6322:Plxna2	UTSW	1	194754367	missense	possibly damaging	0.89
R6668:Plxna2	UTSW	1	194810088	missense	possibly damaging	0.68
R6709:Plxna2	UTSW	1	194789766	missense	probably benign	0.01
R6748:Plxna2	UTSW	1	194794182	splice site	probably null
R6838:Plxna2	UTSW	1	194804914	missense	possibly damaging	0.90
R6844:Plxna2	UTSW	1	194793828	missense	probably benign	0.08
R7069:Plxna2	UTSW	1	194793904	missense	possibly damaging	0.51
R7122:Plxna2	UTSW	1	194644568	nonsense	probably null
R7145:Plxna2	UTSW	1	194649522	missense	probably benign	0.31
R7189:Plxna2	UTSW	1	194801058	missense	possibly damaging	0.58
R7207:Plxna2	UTSW	1	194644019	missense	probably damaging	1.00
R7232:Plxna2	UTSW	1	194712260	missense	probably damaging	1.00
R7234:Plxna2	UTSW	1	194806390	missense	probably damaging	0.96
R7246:Plxna2	UTSW	1	194644282	missense	possibly damaging	0.74
R7255:Plxna2	UTSW	1	194752103	missense	probably benign	0.03
R7283:Plxna2	UTSW	1	194644883	missense	probably damaging	0.99
R7288:Plxna2	UTSW	1	194796919	missense	probably damaging	1.00
R7361:Plxna2	UTSW	1	194799779	missense	probably damaging	1.00
R7424:Plxna2	UTSW	1	194806339	missense	probably damaging	0.98
R7501:Plxna2	UTSW	1	194643895	missense	possibly damaging	0.95
R7528:Plxna2	UTSW	1	194812156	missense	probably damaging	1.00
R7529:Plxna2	UTSW	1	194643871	missense	probably benign	0.25
R7532:Plxna2	UTSW	1	194644819	missense	probably benign	0.13
R7959:Plxna2	UTSW	1	194793864	frame shift	probably null
R7959:Plxna2	UTSW	1	194810962	missense	probably damaging	1.00
R7960:Plxna2	UTSW	1	194793864	frame shift	probably null
R8261:Plxna2	UTSW	1	194749416	missense	probably damaging	1.00
R8301:Plxna2	UTSW	1	194790175	missense	probably benign	0.01
R8463:Plxna2	UTSW	1	194644046	missense	probably damaging	1.00
R8519:Plxna2	UTSW	1	194793958	missense	probably damaging	1.00
R8836:Plxna2	UTSW	1	194796935	missense	possibly damaging	0.94
R9010:Plxna2	UTSW	1	194788909	missense	possibly damaging	0.95
R9034:Plxna2	UTSW	1	194793889	missense	probably damaging	1.00
R9254:Plxna2	UTSW	1	194810166	missense	probably damaging	1.00
R9274:Plxna2	UTSW	1	194788828	missense	probably damaging	1.00
R9379:Plxna2	UTSW	1	194810166	missense	probably damaging	1.00
R9385:Plxna2	UTSW	1	194749416	missense	possibly damaging	0.95
R9422:Plxna2	UTSW	1	194644422	missense	probably damaging	1.00
R9451:Plxna2	UTSW	1	194644384	missense	probably benign	0.05
R9484:Plxna2	UTSW	1	194644894	missense	probably damaging	1.00
X0027:Plxna2	UTSW	1	194644433	missense	probably damaging	1.00
Z1088:Plxna2	UTSW	1	194644441	missense	possibly damaging	0.56
Z1088:Plxna2	UTSW	1	194764539	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TTCTCACTGTCCAGCCAGAGAC -3'
(R):5'- TTTCCCAGCAGCCAGTTGAG -3'

Sequencing Primer
(F):5'- AGAGACCCCTGACGGCATG -3'
(R):5'- AGCCAGTTGAGCTCCAAGTTG -3'

Posted On

2014-08-25