Mutagenetix > Incidental Mutations

Incidental Mutation 'R1966:Orc1'

218935

Institutional Source

Beutler Lab

Gene Symbol

Orc1

Ensembl Gene

ENSMUSG00000028587

Gene Name

origin recognition complex, subunit 1

Synonyms

MmORC1, Orc1l

MMRRC Submission

039979-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1966 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108579423-108614833 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 108612217 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 746 (I746N)

Ref Sequence

ENSEMBL: ENSMUSP00000099805 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102744]

PDB Structure

Structure of free mouse ORC1 BAH domain [X-RAY DIFFRACTION]
Structure of mouse ORC1 BAH domain bound to H4K20me2 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000102744
AA Change: I746N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099805
Gene: ENSMUSG00000028587
AA Change: I746N

Domain	Start	End	E-Value	Type
BAH	44	170	1.88e-31	SMART
low complexity region	394	417	N/A	INTRINSIC
AAA	505	656	1e-7	SMART
Cdc6_C	757	837	5.45e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126668

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is the largest subunit of the ORC complex. While other ORC subunits are stable throughout the cell cycle, the levels of this protein vary during the cell cycle, which has been shown to be controlled by ubiquitin-mediated proteolysis after initiation of DNA replication. This protein is found to be selectively phosphorylated during mitosis. It is also reported to interact with MYST histone acetyltransferase 2 (MyST2/HBO1), a protein involved in control of transcription silencing. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810013L24Rik	A	G	16: 8,830,581	E41G	possibly damaging	Het
2410002F23Rik	T	A	7: 44,251,226	V185E	probably benign	Het
Abca1	A	C	4: 53,050,409	V1608G	probably damaging	Het
Ap2b1	T	C	11: 83,346,895	I557T	probably benign	Het
Arhgef15	G	T	11: 68,954,675	P117Q	probably damaging	Het
Arhgef39	T	C	4: 43,496,710	S335G	probably benign	Het
Blm	A	T	7: 80,513,186	F139Y	possibly damaging	Het
Cacna2d1	C	T	5: 16,333,785	R581*	probably null	Het
Cadps	C	A	14: 12,822,450	E97*	probably null	Het
Cavin2	T	A	1: 51,289,642	L86Q	probably damaging	Het
Ccdc136	A	G	6: 29,418,092	E787G	probably damaging	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Cdh23	T	C	10: 60,323,582	Y2138C	probably damaging	Het
Cdk12	T	A	11: 98,204,090	Y241*	probably null	Het
Clcn4	T	A	7: 7,284,185	*688L	probably null	Het
Cntnap1	T	C	11: 101,180,386	V375A	possibly damaging	Het
Coq5	T	A	5: 115,294,831		probably null	Het
Cyp4b1	A	G	4: 115,625,879	I405T	probably benign	Het
Det1	T	C	7: 78,843,218	Y346C	probably damaging	Het
Enpp3	A	T	10: 24,807,491	V276E	probably damaging	Het
Epb41l2	G	A	10: 25,441,768	R61Q	probably benign	Het
Fam76b	G	A	9: 13,828,066		probably null	Het
Fbxo45	A	T	16: 32,233,230	D238E	probably benign	Het
Fnip2	G	A	3: 79,493,472	T314I	probably benign	Het
Fsip2	T	C	2: 82,992,780	S6286P	possibly damaging	Het
Gbf1	T	C	19: 46,271,564	F999L	probably damaging	Het
Gm14139	T	A	2: 150,191,907	D49E	probably benign	Het
Gnao1	C	A	8: 93,944,199	T102K	probably benign	Het
Gpatch2	T	A	1: 187,322,301	D76E	probably damaging	Het
Gpd1l	A	G	9: 114,914,394	I146T	probably benign	Het
Grik2	A	T	10: 49,355,909	H508Q	probably damaging	Het
Hk3	A	T	13: 55,014,455	F112Y	probably damaging	Het
Hmcn2	T	G	2: 31,389,329	I1781S	probably damaging	Het
Inhba	A	T	13: 16,026,636	K261M	probably damaging	Het
Jarid2	T	A	13: 44,906,276	N661K	probably damaging	Het
Kcna2	T	C	3: 107,104,630	S176P	probably damaging	Het
Kcnj3	A	T	2: 55,437,331	Q44L	probably damaging	Het
Kcns1	G	T	2: 164,168,535	F101L	probably damaging	Het
Kdm5b	T	A	1: 134,613,873		probably null	Het
Klhl14	C	T	18: 21,554,673	G564D	probably damaging	Het
Klhl18	A	T	9: 110,476,590	V2E	probably benign	Het
Klhl6	T	C	16: 19,982,822	E61G	probably damaging	Het
Krt1	T	C	15: 101,848,992	D261G	probably benign	Het
Lama5	C	A	2: 180,188,352	C1896F	probably damaging	Het
Lrba	A	G	3: 86,605,868		probably null	Het
Lrch3	A	G	16: 32,914,385	T82A	possibly damaging	Het
Maml3	C	G	3: 52,104,139	G2A	unknown	Het
Mapkap1	T	A	2: 34,518,679	N34K	probably damaging	Het
Muc13	A	T	16: 33,814,539	I488F	probably damaging	Het
Muc5ac	A	G	7: 141,803,376	D1129G	possibly damaging	Het
Nacc1	A	T	8: 84,676,381	N288K	probably damaging	Het
Nek1	T	G	8: 61,016,296	I129R	probably damaging	Het
Nf1	T	A	11: 79,411,564	S319R	possibly damaging	Het
Nle1	C	T	11: 82,901,788	G432D	probably damaging	Het
Nol4l	A	G	2: 153,529,455	V103A	probably benign	Het
Oca2	A	G	7: 56,414,467	I737V	probably damaging	Het
Olfr1270	T	C	2: 90,149,404	S201G	probably damaging	Het
Olfr231	G	T	1: 174,117,251	S255*	probably null	Het
Olfr346	G	A	2: 36,688,784	V261I	probably benign	Het
Olfr358	A	T	2: 37,004,948	F222Y	possibly damaging	Het
Olfr630	G	T	7: 103,755,168	T139K	probably damaging	Het
Olfr655	A	G	7: 104,596,801	C127R	probably damaging	Het
Olfr750	T	A	14: 51,071,157	I79F	probably damaging	Het
Pbxip1	A	G	3: 89,445,488	D147G	probably damaging	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Plin5	T	A	17: 56,112,186	D412V	probably damaging	Het
Plxna2	A	T	1: 194,644,700	Y314F	possibly damaging	Het
Ppid	A	T	3: 79,602,299	K308*	probably null	Het
Prss38	T	C	11: 59,373,484	Y219C	probably damaging	Het
Ptx3	C	T	3: 66,224,621	R188C	probably damaging	Het
Ralgds	T	A	2: 28,545,875	V504E	probably damaging	Het
Rere	T	C	4: 150,616,873	Y1237H	probably damaging	Het
Rpp30	C	T	19: 36,089,149	S94L	probably damaging	Het
Rrp15	C	T	1: 186,736,205	V205I	possibly damaging	Het
Scpep1	A	G	11: 88,952,414	W73R	probably damaging	Het
Sec23ip	A	G	7: 128,755,353	H376R	probably damaging	Het
Serping1	G	T	2: 84,765,728	T454K	probably damaging	Het
Shtn1	T	G	19: 58,975,038	Y615S	probably benign	Het
Slc20a2	C	A	8: 22,545,537	P184T	probably damaging	Het
Slc22a29	C	A	19: 8,218,408	R89L	probably damaging	Het
Slc2a2	A	G	3: 28,719,485	Q313R	probably damaging	Het
Tas2r122	A	T	6: 132,711,194	Y245*	probably null	Het
Ticrr	C	A	7: 79,694,735	C1449*	probably null	Het
Tmem181a	T	C	17: 6,303,226	V412A	probably benign	Het
Tmtc4	T	A	14: 122,927,599	E616V	probably benign	Het
Tnrc6b	A	G	15: 80,880,439	K714R	probably damaging	Het
Trpm8	T	A	1: 88,332,748		probably null	Het
Ubr2	T	C	17: 46,954,919	T1163A	probably benign	Het
Ubr4	A	G	4: 139,451,244		probably null	Het
Ulk2	A	T	11: 61,819,471		probably null	Het
Ulk4	T	A	9: 121,257,116	M350L	probably benign	Het
Vmn1r185	T	C	7: 26,611,531	E183G	probably benign	Het
Vmn1r76	T	A	7: 11,930,514	I223F	probably damaging	Het
Wdr27	T	C	17: 14,934,599	T19A	possibly damaging	Het
Wdr59	T	G	8: 111,450,903	T973P	possibly damaging	Het
Wnk2	A	G	13: 49,039,011	S664P	probably damaging	Het
Zfp120	A	T	2: 150,117,398	C335S	probably damaging	Het
Zfp30	C	A	7: 29,792,452	Q44K	probably benign	Het
Zfp541	T	C	7: 16,079,071	S550P	probably benign	Het
Zw10	C	A	9: 49,068,833	N421K	probably damaging	Het

Other mutations in Orc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Orc1	APN	4	108595325	splice site	probably benign
IGL00709:Orc1	APN	4	108590778	critical splice donor site	probably null
IGL01124:Orc1	APN	4	108588787	splice site	probably benign
IGL01514:Orc1	APN	4	108602052	missense	probably damaging	0.97
IGL01677:Orc1	APN	4	108604585	missense	probably damaging	1.00
IGL01782:Orc1	APN	4	108606268	missense	possibly damaging	0.78
IGL01886:Orc1	APN	4	108603957	splice site	probably null
IGL01912:Orc1	APN	4	108590744	missense	probably damaging	1.00
IGL02057:Orc1	APN	4	108588729	missense	possibly damaging	0.53
IGL02155:Orc1	APN	4	108590677	missense	probably benign	0.00
IGL02311:Orc1	APN	4	108599974	missense	probably benign
IGL02616:Orc1	APN	4	108595479	missense	probably benign	0.00
R0012:Orc1	UTSW	4	108595646	critical splice donor site	probably null
R0195:Orc1	UTSW	4	108614308	nonsense	probably null
R0239:Orc1	UTSW	4	108595646	critical splice donor site	probably null
R0239:Orc1	UTSW	4	108595646	critical splice donor site	probably null
R0611:Orc1	UTSW	4	108602032	missense	probably benign
R1351:Orc1	UTSW	4	108595367	missense	probably benign	0.01
R2018:Orc1	UTSW	4	108590700	missense	possibly damaging	0.95
R2398:Orc1	UTSW	4	108601969	missense	possibly damaging	0.68
R3110:Orc1	UTSW	4	108604560	missense	probably benign	0.01
R3112:Orc1	UTSW	4	108604560	missense	probably benign	0.01
R3712:Orc1	UTSW	4	108604021	missense	probably damaging	1.00
R3716:Orc1	UTSW	4	108614459	missense	probably damaging	1.00
R3829:Orc1	UTSW	4	108605631	missense	probably damaging	1.00
R4282:Orc1	UTSW	4	108606274	missense	probably benign	0.18
R4320:Orc1	UTSW	4	108588776	missense	probably benign
R4321:Orc1	UTSW	4	108588776	missense	probably benign
R4322:Orc1	UTSW	4	108588776	missense	probably benign
R4348:Orc1	UTSW	4	108593452	missense	probably damaging	0.98
R4562:Orc1	UTSW	4	108602055	critical splice donor site	probably null
R4772:Orc1	UTSW	4	108579568	utr 5 prime	probably benign
R4914:Orc1	UTSW	4	108604558	missense	probably damaging	1.00
R4964:Orc1	UTSW	4	108614473	makesense	probably null
R5219:Orc1	UTSW	4	108590769	missense	probably damaging	1.00
R5428:Orc1	UTSW	4	108599940	missense	probably benign	0.00
R5655:Orc1	UTSW	4	108593439	missense	probably benign	0.09
R5693:Orc1	UTSW	4	108613079	missense	probably benign	0.01
R5936:Orc1	UTSW	4	108601983	missense	probably benign	0.10
R5960:Orc1	UTSW	4	108606298	missense	possibly damaging	0.67
R6294:Orc1	UTSW	4	108590670	missense	probably benign	0.01
R6504:Orc1	UTSW	4	108590717	missense	probably benign	0.15
R6533:Orc1	UTSW	4	108597447	missense	probably benign	0.05
R6775:Orc1	UTSW	4	108603455	missense	probably damaging	1.00
R7123:Orc1	UTSW	4	108588687	start codon destroyed	probably damaging	0.99
R7156:Orc1	UTSW	4	108595459	missense	probably benign	0.00
R7327:Orc1	UTSW	4	108588714	missense	probably benign	0.01
R7552:Orc1	UTSW	4	108588754	missense	probably benign	0.41
R7842:Orc1	UTSW	4	108605547	missense	probably benign	0.00
R7899:Orc1	UTSW	4	108603371	splice site	probably null
R8033:Orc1	UTSW	4	108605564	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTACCTGAGATGGCAAGTGC -3'
(R):5'- TACCCAAGGATTGTGTTGCC -3'

Sequencing Primer
(F):5'- CATCTTCTAGTGTGCCTGAAGACAG -3'
(R):5'- CCCAAGGATTGTGTTGCCTTACG -3'

Posted On

2014-08-25