Incidental Mutation 'R1966:Ticrr'
ID 218954
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
MMRRC Submission 039979-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R1966 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 79309944-79347896 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 79344483 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 1449 (C1449*)
Ref Sequence ENSEMBL: ENSMUSP00000041377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000059836] [ENSMUST00000178048] [ENSMUST00000183846] [ENSMUST00000184137] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect probably null
Transcript: ENSMUST00000035977
AA Change: C1449*
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: C1449*

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059836
SMART Domains Protein: ENSMUSP00000061806
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178048
SMART Domains Protein: ENSMUSP00000136993
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183846
SMART Domains Protein: ENSMUSP00000139359
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184137
SMART Domains Protein: ENSMUSP00000139224
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206591
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410002F23Rik T A 7: 43,900,650 (GRCm39) V185E probably benign Het
Abca1 A C 4: 53,050,409 (GRCm39) V1608G probably damaging Het
Ap2b1 T C 11: 83,237,721 (GRCm39) I557T probably benign Het
Arhgef15 G T 11: 68,845,501 (GRCm39) P117Q probably damaging Het
Arhgef39 T C 4: 43,496,710 (GRCm39) S335G probably benign Het
Blm A T 7: 80,162,934 (GRCm39) F139Y possibly damaging Het
Cacna2d1 C T 5: 16,538,783 (GRCm39) R581* probably null Het
Cadps C A 14: 12,822,450 (GRCm38) E97* probably null Het
Cavin2 T A 1: 51,328,801 (GRCm39) L86Q probably damaging Het
Ccdc136 A G 6: 29,418,091 (GRCm39) E787G probably damaging Het
Ccdc39 T C 3: 33,880,629 (GRCm39) K446R probably damaging Het
Cdh23 T C 10: 60,159,361 (GRCm39) Y2138C probably damaging Het
Cdk12 T A 11: 98,094,916 (GRCm39) Y241* probably null Het
Clcn4 T A 7: 7,287,184 (GRCm39) *688L probably null Het
Cntnap1 T C 11: 101,071,212 (GRCm39) V375A possibly damaging Het
Coq5 T A 5: 115,432,890 (GRCm39) probably null Het
Cyp4b1 A G 4: 115,483,076 (GRCm39) I405T probably benign Het
Det1 T C 7: 78,492,966 (GRCm39) Y346C probably damaging Het
Enpp3 A T 10: 24,683,389 (GRCm39) V276E probably damaging Het
Epb41l2 G A 10: 25,317,666 (GRCm39) R61Q probably benign Het
Fam76b G A 9: 13,739,362 (GRCm39) probably null Het
Fbxo45 A T 16: 32,052,048 (GRCm39) D238E probably benign Het
Fnip2 G A 3: 79,400,779 (GRCm39) T314I probably benign Het
Fsip2 T C 2: 82,823,124 (GRCm39) S6286P possibly damaging Het
Gbf1 T C 19: 46,260,003 (GRCm39) F999L probably damaging Het
Gnao1 C A 8: 94,670,827 (GRCm39) T102K probably benign Het
Gpatch2 T A 1: 187,054,498 (GRCm39) D76E probably damaging Het
Gpd1l A G 9: 114,743,462 (GRCm39) I146T probably benign Het
Grik2 A T 10: 49,232,005 (GRCm39) H508Q probably damaging Het
Hapstr1 A G 16: 8,648,445 (GRCm39) E41G possibly damaging Het
Hk3 A T 13: 55,162,268 (GRCm39) F112Y probably damaging Het
Hmcn2 T G 2: 31,279,341 (GRCm39) I1781S probably damaging Het
Inhba A T 13: 16,201,221 (GRCm39) K261M probably damaging Het
Jarid2 T A 13: 45,059,752 (GRCm39) N661K probably damaging Het
Kcna2 T C 3: 107,011,946 (GRCm39) S176P probably damaging Het
Kcnj3 A T 2: 55,327,343 (GRCm39) Q44L probably damaging Het
Kcns1 G T 2: 164,010,455 (GRCm39) F101L probably damaging Het
Kdm5b T A 1: 134,541,611 (GRCm39) probably null Het
Klhl14 C T 18: 21,687,730 (GRCm39) G564D probably damaging Het
Klhl18 A T 9: 110,305,658 (GRCm39) V2E probably benign Het
Klhl6 T C 16: 19,801,572 (GRCm39) E61G probably damaging Het
Krt1 T C 15: 101,757,427 (GRCm39) D261G probably benign Het
Lama5 C A 2: 179,830,145 (GRCm39) C1896F probably damaging Het
Lrba A G 3: 86,513,175 (GRCm39) probably null Het
Lrch3 A G 16: 32,734,755 (GRCm39) T82A possibly damaging Het
Maml3 C G 3: 52,011,560 (GRCm39) G2A unknown Het
Mapkap1 T A 2: 34,408,691 (GRCm39) N34K probably damaging Het
Muc13 A T 16: 33,634,909 (GRCm39) I488F probably damaging Het
Muc5ac A G 7: 141,357,113 (GRCm39) D1129G possibly damaging Het
Nacc1 A T 8: 85,403,010 (GRCm39) N288K probably damaging Het
Nek1 T G 8: 61,469,330 (GRCm39) I129R probably damaging Het
Nf1 T A 11: 79,302,390 (GRCm39) S319R possibly damaging Het
Nle1 C T 11: 82,792,614 (GRCm39) G432D probably damaging Het
Nol4l A G 2: 153,371,375 (GRCm39) V103A probably benign Het
Oca2 A G 7: 56,064,215 (GRCm39) I737V probably damaging Het
Or12k5 A T 2: 36,894,960 (GRCm39) F222Y possibly damaging Het
Or1j17 G A 2: 36,578,796 (GRCm39) V261I probably benign Het
Or4b1 T C 2: 89,979,748 (GRCm39) S201G probably damaging Het
Or51l4 G T 7: 103,404,375 (GRCm39) T139K probably damaging Het
Or52ac1 A G 7: 104,246,008 (GRCm39) C127R probably damaging Het
Or6k6 G T 1: 173,944,817 (GRCm39) S255* probably null Het
Or6s1 T A 14: 51,308,614 (GRCm39) I79F probably damaging Het
Orc1 T A 4: 108,469,414 (GRCm39) I746N probably damaging Het
Pbxip1 A G 3: 89,352,795 (GRCm39) D147G probably damaging Het
Pirb A T 7: 3,720,637 (GRCm39) L287Q probably benign Het
Plin5 T A 17: 56,419,186 (GRCm39) D412V probably damaging Het
Plxna2 A T 1: 194,327,008 (GRCm39) Y314F possibly damaging Het
Ppid A T 3: 79,509,606 (GRCm39) K308* probably null Het
Prss38 T C 11: 59,264,310 (GRCm39) Y219C probably damaging Het
Ptx3 C T 3: 66,132,042 (GRCm39) R188C probably damaging Het
Ralgds T A 2: 28,435,887 (GRCm39) V504E probably damaging Het
Rere T C 4: 150,701,330 (GRCm39) Y1237H probably damaging Het
Rpp30 C T 19: 36,066,549 (GRCm39) S94L probably damaging Het
Rrp15 C T 1: 186,468,402 (GRCm39) V205I possibly damaging Het
Scpep1 A G 11: 88,843,240 (GRCm39) W73R probably damaging Het
Sec23ip A G 7: 128,357,077 (GRCm39) H376R probably damaging Het
Serping1 G T 2: 84,596,072 (GRCm39) T454K probably damaging Het
Shtn1 T G 19: 58,963,470 (GRCm39) Y615S probably benign Het
Slc20a2 C A 8: 23,035,553 (GRCm39) P184T probably damaging Het
Slc22a29 C A 19: 8,195,772 (GRCm39) R89L probably damaging Het
Slc2a2 A G 3: 28,773,634 (GRCm39) Q313R probably damaging Het
Tas2r122 A T 6: 132,688,157 (GRCm39) Y245* probably null Het
Tmem181a T C 17: 6,353,501 (GRCm39) V412A probably benign Het
Tmtc4 T A 14: 123,165,011 (GRCm39) E616V probably benign Het
Tnrc6b A G 15: 80,764,640 (GRCm39) K714R probably damaging Het
Trpm8 T A 1: 88,260,470 (GRCm39) probably null Het
Ubr2 T C 17: 47,265,845 (GRCm39) T1163A probably benign Het
Ubr4 A G 4: 139,178,555 (GRCm39) probably null Het
Ulk2 A T 11: 61,710,297 (GRCm39) probably null Het
Ulk4 T A 9: 121,086,182 (GRCm39) M350L probably benign Het
Vmn1r185 T C 7: 26,310,956 (GRCm39) E183G probably benign Het
Vmn1r76 T A 7: 11,664,441 (GRCm39) I223F probably damaging Het
Wdr27 T C 17: 15,154,861 (GRCm39) T19A possibly damaging Het
Wdr59 T G 8: 112,177,535 (GRCm39) T973P possibly damaging Het
Wnk2 A G 13: 49,192,487 (GRCm39) S664P probably damaging Het
Zfp1004 T A 2: 150,033,827 (GRCm39) D49E probably benign Het
Zfp120 A T 2: 149,959,318 (GRCm39) C335S probably damaging Het
Zfp30 C A 7: 29,491,877 (GRCm39) Q44K probably benign Het
Zfp541 T C 7: 15,812,996 (GRCm39) S550P probably benign Het
Zw10 C A 9: 48,980,133 (GRCm39) N421K probably damaging Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79,327,031 (GRCm39) missense probably damaging 1.00
IGL00596:Ticrr APN 7 79,327,041 (GRCm39) missense probably damaging 1.00
IGL01327:Ticrr APN 7 79,344,209 (GRCm39) missense probably benign 0.00
IGL01525:Ticrr APN 7 79,332,197 (GRCm39) missense probably damaging 1.00
IGL01565:Ticrr APN 7 79,344,296 (GRCm39) missense probably benign
IGL01936:Ticrr APN 7 79,344,297 (GRCm39) missense probably benign 0.11
IGL02160:Ticrr APN 7 79,343,767 (GRCm39) missense probably benign 0.29
IGL02246:Ticrr APN 7 79,325,076 (GRCm39) missense probably damaging 1.00
IGL02487:Ticrr APN 7 79,332,769 (GRCm39) missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79,345,214 (GRCm39) missense probably damaging 0.99
IGL02970:Ticrr APN 7 79,344,919 (GRCm39) missense probably benign 0.01
FR4304:Ticrr UTSW 7 79,344,059 (GRCm39) intron probably benign
PIT4305001:Ticrr UTSW 7 79,328,771 (GRCm39) missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79,319,386 (GRCm39) missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79,343,540 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0362:Ticrr UTSW 7 79,327,088 (GRCm39) missense probably damaging 1.00
R0482:Ticrr UTSW 7 79,344,236 (GRCm39) missense probably damaging 0.99
R0595:Ticrr UTSW 7 79,345,311 (GRCm39) missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1119:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1572:Ticrr UTSW 7 79,331,572 (GRCm39) missense probably damaging 1.00
R1658:Ticrr UTSW 7 79,345,297 (GRCm39) missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79,328,794 (GRCm39) nonsense probably null
R1757:Ticrr UTSW 7 79,325,071 (GRCm39) missense probably damaging 0.99
R1862:Ticrr UTSW 7 79,344,955 (GRCm39) missense probably damaging 1.00
R1869:Ticrr UTSW 7 79,328,883 (GRCm39) missense probably damaging 1.00
R1938:Ticrr UTSW 7 79,325,142 (GRCm39) missense probably damaging 0.98
R2006:Ticrr UTSW 7 79,343,821 (GRCm39) missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79,315,433 (GRCm39) missense probably benign 0.12
R3404:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3405:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3941:Ticrr UTSW 7 79,343,445 (GRCm39) intron probably benign
R3950:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3951:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3952:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R4967:Ticrr UTSW 7 79,310,158 (GRCm39) missense probably damaging 0.99
R4972:Ticrr UTSW 7 79,319,416 (GRCm39) missense probably damaging 0.98
R5259:Ticrr UTSW 7 79,344,471 (GRCm39) missense probably benign 0.01
R5272:Ticrr UTSW 7 79,319,353 (GRCm39) missense probably benign 0.44
R5374:Ticrr UTSW 7 79,340,690 (GRCm39) nonsense probably null
R5480:Ticrr UTSW 7 79,310,557 (GRCm39) missense probably damaging 1.00
R5568:Ticrr UTSW 7 79,345,044 (GRCm39) nonsense probably null
R5568:Ticrr UTSW 7 79,339,715 (GRCm39) critical splice donor site probably null
R5588:Ticrr UTSW 7 79,328,853 (GRCm39) missense probably damaging 1.00
R5698:Ticrr UTSW 7 79,328,881 (GRCm39) missense probably benign
R5879:Ticrr UTSW 7 79,346,438 (GRCm39) missense probably benign 0.12
R5980:Ticrr UTSW 7 79,310,703 (GRCm39) missense probably damaging 0.99
R6128:Ticrr UTSW 7 79,343,716 (GRCm39) missense probably damaging 1.00
R6277:Ticrr UTSW 7 79,344,444 (GRCm39) missense probably benign 0.00
R6335:Ticrr UTSW 7 79,344,031 (GRCm39) splice site probably null
R6866:Ticrr UTSW 7 79,343,705 (GRCm39) missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79,315,598 (GRCm39) missense probably benign 0.00
R6923:Ticrr UTSW 7 79,341,601 (GRCm39) missense probably damaging 0.98
R6962:Ticrr UTSW 7 79,315,645 (GRCm39) missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79,343,490 (GRCm39) missense probably damaging 0.96
R7285:Ticrr UTSW 7 79,310,610 (GRCm39) missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79,341,597 (GRCm39) missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79,343,734 (GRCm39) missense probably benign
R7583:Ticrr UTSW 7 79,346,487 (GRCm39) nonsense probably null
R7749:Ticrr UTSW 7 79,328,844 (GRCm39) missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79,331,760 (GRCm39) missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79,319,233 (GRCm39) missense probably benign 0.23
R7935:Ticrr UTSW 7 79,331,584 (GRCm39) missense probably damaging 0.99
R8005:Ticrr UTSW 7 79,343,796 (GRCm39) missense probably damaging 0.98
R8080:Ticrr UTSW 7 79,334,012 (GRCm39) splice site probably null
R8181:Ticrr UTSW 7 79,310,728 (GRCm39) missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R8410:Ticrr UTSW 7 79,317,423 (GRCm39) missense probably damaging 0.98
R8449:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R9073:Ticrr UTSW 7 79,317,679 (GRCm39) missense probably benign 0.01
R9090:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79,343,516 (GRCm39) missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79,330,735 (GRCm39) missense probably damaging 0.99
R9469:Ticrr UTSW 7 79,344,511 (GRCm39) missense probably benign 0.03
R9502:Ticrr UTSW 7 79,343,597 (GRCm39) missense probably benign
R9614:Ticrr UTSW 7 79,345,754 (GRCm39) missense probably damaging 1.00
R9761:Ticrr UTSW 7 79,345,313 (GRCm39) missense probably damaging 1.00
R9779:Ticrr UTSW 7 79,328,802 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AAAGAAGTCCTGTCCTCCTCAG -3'
(R):5'- TGAGCAGCATCTTGCCTCTG -3'

Sequencing Primer
(F):5'- TCCTCAGGACTTCCCAGAGTG -3'
(R):5'- TGTACAGCACAGGGGGTAG -3'
Posted On 2014-08-25