Mutagenetix > Incidental Mutations

Incidental Mutation 'R1966:Grik2'

218974

Institutional Source

Beutler Lab

Gene Symbol

Grik2

Ensembl Gene

ENSMUSG00000056073

Gene Name

glutamate receptor, ionotropic, kainate 2 (beta 2)

Synonyms

Glurbeta2, Glur-6, Glur6

MMRRC Submission

039979-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1966 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

49094833-49788766 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 49355909 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 508 (H508Q)

Ref Sequence

ENSEMBL: ENSMUSP00000151921 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079751] [ENSMUST00000105484] [ENSMUST00000218441] [ENSMUST00000218598] [ENSMUST00000218669] [ENSMUST00000218823]

Predicted Effect

probably damaging
Transcript: ENSMUST00000079751
AA Change: H508Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000078687
Gene: ENSMUSG00000056073
AA Change: H508Q

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	44	386	1.8e-11	PFAM
Pfam:ANF_receptor	52	395	8.3e-75	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	2e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000105484
AA Change: H508Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000101124
Gene: ENSMUSG00000056073
AA Change: H508Q

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	46	386	5e-11	PFAM
Pfam:ANF_receptor	52	395	9.7e-80	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	1e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000105485
AA Change: H508Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000101125
Gene: ENSMUSG00000056073
AA Change: H508Q

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	44	386	1.8e-11	PFAM
Pfam:ANF_receptor	52	395	8.3e-75	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	2e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000105486
AA Change: H508Q

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000101126
Gene: ENSMUSG00000056073
AA Change: H508Q

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	44	386	3.8e-11	PFAM
Pfam:ANF_receptor	52	395	1.5e-74	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	6e-13	BLAST
low complexity region	875	891	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000105487
AA Change: H508Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000101127
Gene: ENSMUSG00000056073
AA Change: H508Q

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	46	386	5e-11	PFAM
Pfam:ANF_receptor	52	395	9.7e-80	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	1e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000218441
AA Change: H508Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000218598
AA Change: H508Q

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

probably benign
Transcript: ENSMUST00000218669

Predicted Effect

probably damaging
Transcript: ENSMUST00000218823
AA Change: H508Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219051

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing at multiple sites within the first and second transmembrane domains, which is thought to alter the structure and function of the receptor complex. Alternatively spliced transcript variants encoding different isoforms have also been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hippocampal neurons with reduced sensitivity to kainate and reduced susceptibility to the seizure-inducing effects of kainate administration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810013L24Rik	A	G	16: 8,830,581	E41G	possibly damaging	Het
2410002F23Rik	T	A	7: 44,251,226	V185E	probably benign	Het
Abca1	A	C	4: 53,050,409	V1608G	probably damaging	Het
Ap2b1	T	C	11: 83,346,895	I557T	probably benign	Het
Arhgef15	G	T	11: 68,954,675	P117Q	probably damaging	Het
Arhgef39	T	C	4: 43,496,710	S335G	probably benign	Het
Blm	A	T	7: 80,513,186	F139Y	possibly damaging	Het
Cacna2d1	C	T	5: 16,333,785	R581*	probably null	Het
Cadps	C	A	14: 12,822,450	E97*	probably null	Het
Cavin2	T	A	1: 51,289,642	L86Q	probably damaging	Het
Ccdc136	A	G	6: 29,418,092	E787G	probably damaging	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Cdh23	T	C	10: 60,323,582	Y2138C	probably damaging	Het
Cdk12	T	A	11: 98,204,090	Y241*	probably null	Het
Clcn4	T	A	7: 7,284,185	*688L	probably null	Het
Cntnap1	T	C	11: 101,180,386	V375A	possibly damaging	Het
Coq5	T	A	5: 115,294,831		probably null	Het
Cyp4b1	A	G	4: 115,625,879	I405T	probably benign	Het
Det1	T	C	7: 78,843,218	Y346C	probably damaging	Het
Enpp3	A	T	10: 24,807,491	V276E	probably damaging	Het
Epb41l2	G	A	10: 25,441,768	R61Q	probably benign	Het
Fam76b	G	A	9: 13,828,066		probably null	Het
Fbxo45	A	T	16: 32,233,230	D238E	probably benign	Het
Fnip2	G	A	3: 79,493,472	T314I	probably benign	Het
Fsip2	T	C	2: 82,992,780	S6286P	possibly damaging	Het
Gbf1	T	C	19: 46,271,564	F999L	probably damaging	Het
Gm14139	T	A	2: 150,191,907	D49E	probably benign	Het
Gnao1	C	A	8: 93,944,199	T102K	probably benign	Het
Gpatch2	T	A	1: 187,322,301	D76E	probably damaging	Het
Gpd1l	A	G	9: 114,914,394	I146T	probably benign	Het
Hk3	A	T	13: 55,014,455	F112Y	probably damaging	Het
Hmcn2	T	G	2: 31,389,329	I1781S	probably damaging	Het
Inhba	A	T	13: 16,026,636	K261M	probably damaging	Het
Jarid2	T	A	13: 44,906,276	N661K	probably damaging	Het
Kcna2	T	C	3: 107,104,630	S176P	probably damaging	Het
Kcnj3	A	T	2: 55,437,331	Q44L	probably damaging	Het
Kcns1	G	T	2: 164,168,535	F101L	probably damaging	Het
Kdm5b	T	A	1: 134,613,873		probably null	Het
Klhl14	C	T	18: 21,554,673	G564D	probably damaging	Het
Klhl18	A	T	9: 110,476,590	V2E	probably benign	Het
Klhl6	T	C	16: 19,982,822	E61G	probably damaging	Het
Krt1	T	C	15: 101,848,992	D261G	probably benign	Het
Lama5	C	A	2: 180,188,352	C1896F	probably damaging	Het
Lrba	A	G	3: 86,605,868		probably null	Het
Lrch3	A	G	16: 32,914,385	T82A	possibly damaging	Het
Maml3	C	G	3: 52,104,139	G2A	unknown	Het
Mapkap1	T	A	2: 34,518,679	N34K	probably damaging	Het
Muc13	A	T	16: 33,814,539	I488F	probably damaging	Het
Muc5ac	A	G	7: 141,803,376	D1129G	possibly damaging	Het
Nacc1	A	T	8: 84,676,381	N288K	probably damaging	Het
Nek1	T	G	8: 61,016,296	I129R	probably damaging	Het
Nf1	T	A	11: 79,411,564	S319R	possibly damaging	Het
Nle1	C	T	11: 82,901,788	G432D	probably damaging	Het
Nol4l	A	G	2: 153,529,455	V103A	probably benign	Het
Oca2	A	G	7: 56,414,467	I737V	probably damaging	Het
Olfr1270	T	C	2: 90,149,404	S201G	probably damaging	Het
Olfr231	G	T	1: 174,117,251	S255*	probably null	Het
Olfr346	G	A	2: 36,688,784	V261I	probably benign	Het
Olfr358	A	T	2: 37,004,948	F222Y	possibly damaging	Het
Olfr630	G	T	7: 103,755,168	T139K	probably damaging	Het
Olfr655	A	G	7: 104,596,801	C127R	probably damaging	Het
Olfr750	T	A	14: 51,071,157	I79F	probably damaging	Het
Orc1	T	A	4: 108,612,217	I746N	probably damaging	Het
Pbxip1	A	G	3: 89,445,488	D147G	probably damaging	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Plin5	T	A	17: 56,112,186	D412V	probably damaging	Het
Plxna2	A	T	1: 194,644,700	Y314F	possibly damaging	Het
Ppid	A	T	3: 79,602,299	K308*	probably null	Het
Prss38	T	C	11: 59,373,484	Y219C	probably damaging	Het
Ptx3	C	T	3: 66,224,621	R188C	probably damaging	Het
Ralgds	T	A	2: 28,545,875	V504E	probably damaging	Het
Rere	T	C	4: 150,616,873	Y1237H	probably damaging	Het
Rpp30	C	T	19: 36,089,149	S94L	probably damaging	Het
Rrp15	C	T	1: 186,736,205	V205I	possibly damaging	Het
Scpep1	A	G	11: 88,952,414	W73R	probably damaging	Het
Sec23ip	A	G	7: 128,755,353	H376R	probably damaging	Het
Serping1	G	T	2: 84,765,728	T454K	probably damaging	Het
Shtn1	T	G	19: 58,975,038	Y615S	probably benign	Het
Slc20a2	C	A	8: 22,545,537	P184T	probably damaging	Het
Slc22a29	C	A	19: 8,218,408	R89L	probably damaging	Het
Slc2a2	A	G	3: 28,719,485	Q313R	probably damaging	Het
Tas2r122	A	T	6: 132,711,194	Y245*	probably null	Het
Ticrr	C	A	7: 79,694,735	C1449*	probably null	Het
Tmem181a	T	C	17: 6,303,226	V412A	probably benign	Het
Tmtc4	T	A	14: 122,927,599	E616V	probably benign	Het
Tnrc6b	A	G	15: 80,880,439	K714R	probably damaging	Het
Trpm8	T	A	1: 88,332,748		probably null	Het
Ubr2	T	C	17: 46,954,919	T1163A	probably benign	Het
Ubr4	A	G	4: 139,451,244		probably null	Het
Ulk2	A	T	11: 61,819,471		probably null	Het
Ulk4	T	A	9: 121,257,116	M350L	probably benign	Het
Vmn1r185	T	C	7: 26,611,531	E183G	probably benign	Het
Vmn1r76	T	A	7: 11,930,514	I223F	probably damaging	Het
Wdr27	T	C	17: 14,934,599	T19A	possibly damaging	Het
Wdr59	T	G	8: 111,450,903	T973P	possibly damaging	Het
Wnk2	A	G	13: 49,039,011	S664P	probably damaging	Het
Zfp120	A	T	2: 150,117,398	C335S	probably damaging	Het
Zfp30	C	A	7: 29,792,452	Q44K	probably benign	Het
Zfp541	T	C	7: 16,079,071	S550P	probably benign	Het
Zw10	C	A	9: 49,068,833	N421K	probably damaging	Het

Other mutations in Grik2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00863:Grik2	APN	10	49355928	missense	possibly damaging	0.95
IGL00979:Grik2	APN	10	49355938	missense	probably damaging	1.00
IGL01012:Grik2	APN	10	49272956	missense	probably damaging	1.00
IGL01302:Grik2	APN	10	49244330	missense	probably damaging	0.99
IGL01657:Grik2	APN	10	49527986	critical splice donor site	probably null
IGL02162:Grik2	APN	10	49422575	missense	possibly damaging	0.77
IGL02317:Grik2	APN	10	49422615	missense	probably benign	0.16
IGL02512:Grik2	APN	10	49355912	missense	probably benign	0.00
IGL02650:Grik2	APN	10	49101235	missense	probably benign	0.03
IGL03283:Grik2	APN	10	49578269	missense	probably benign	0.00
BB004:Grik2	UTSW	10	49240794	missense	probably damaging	1.00
BB014:Grik2	UTSW	10	49240794	missense	probably damaging	1.00
R0325:Grik2	UTSW	10	49240725	missense	probably damaging	1.00
R0492:Grik2	UTSW	10	49101164	missense	probably damaging	0.99
R0601:Grik2	UTSW	10	49422597	missense	probably damaging	1.00
R0844:Grik2	UTSW	10	49101115	missense	possibly damaging	0.81
R1333:Grik2	UTSW	10	49527991	missense	probably damaging	0.98
R1499:Grik2	UTSW	10	49132775	missense	probably damaging	1.00
R1660:Grik2	UTSW	10	49244343	nonsense	probably null
R1721:Grik2	UTSW	10	49523746	missense	possibly damaging	0.93
R1974:Grik2	UTSW	10	49132827	missense	possibly damaging	0.85
R2246:Grik2	UTSW	10	49535436	missense	probably damaging	1.00
R3103:Grik2	UTSW	10	49240772	missense	probably damaging	1.00
R3974:Grik2	UTSW	10	49422654	missense	probably damaging	1.00
R4592:Grik2	UTSW	10	49422615	missense	possibly damaging	0.48
R4658:Grik2	UTSW	10	49523792	missense	possibly damaging	0.71
R4748:Grik2	UTSW	10	49535341	missense	possibly damaging	0.87
R4935:Grik2	UTSW	10	49240730	missense	probably damaging	1.00
R4977:Grik2	UTSW	10	49132745	missense	probably damaging	1.00
R5103:Grik2	UTSW	10	49496109	missense	probably benign	0.33
R5330:Grik2	UTSW	10	49132771	missense	probably damaging	1.00
R5331:Grik2	UTSW	10	49132771	missense	probably damaging	1.00
R5736:Grik2	UTSW	10	49404410	missense	probably damaging	0.96
R5740:Grik2	UTSW	10	49113477	missense	probably damaging	0.99
R5747:Grik2	UTSW	10	49523774	missense	probably benign
R6015:Grik2	UTSW	10	49523863	splice site	probably null
R6311:Grik2	UTSW	10	49578138	missense	probably damaging	0.98
R6474:Grik2	UTSW	10	49132680	missense	probably benign
R6504:Grik2	UTSW	10	49356102	missense	probably damaging	1.00
R6591:Grik2	UTSW	10	49272925	nonsense	probably null
R6691:Grik2	UTSW	10	49272925	nonsense	probably null
R6776:Grik2	UTSW	10	49355989	missense	probably damaging	1.00
R7015:Grik2	UTSW	10	49535436	missense	probably damaging	1.00
R7094:Grik2	UTSW	10	49355916	missense	possibly damaging	0.75
R7153:Grik2	UTSW	10	49535367	missense	probably benign	0.00
R7229:Grik2	UTSW	10	49101416	splice site	probably null
R7402:Grik2	UTSW	10	49535397	missense	probably damaging	1.00
R7473:Grik2	UTSW	10	49113522	missense	probably benign	0.22
R7514:Grik2	UTSW	10	49523808	missense	probably damaging	0.99
R7526:Grik2	UTSW	10	49523822	missense	possibly damaging	0.56
R7657:Grik2	UTSW	10	49783151	missense	probably benign	0.11
R7681:Grik2	UTSW	10	49244380	missense	probably damaging	1.00
R7714:Grik2	UTSW	10	49419696	missense	probably damaging	0.97
R7927:Grik2	UTSW	10	49240794	missense	probably damaging	1.00
R7952:Grik2	UTSW	10	49422537	missense	probably benign	0.15
R7979:Grik2	UTSW	10	49404342	missense	probably benign	0.01
R8062:Grik2	UTSW	10	49240767	missense	probably damaging	1.00
R8222:Grik2	UTSW	10	49573648	missense	probably benign	0.29
R8406:Grik2	UTSW	10	49272767	missense	probably damaging	1.00
RF008:Grik2	UTSW	10	49244384	missense	probably damaging	1.00
X0062:Grik2	UTSW	10	49272920	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCTCCATAGAAGGGGAATTCTAG -3'
(R):5'- GACAAACCTCTCTATGGGAATGATC -3'

Sequencing Primer
(F):5'- TAGTGGAGCAGCTTCTTAGAGGC -3'
(R):5'- ACCTCTCTATGGGAATGATCGATTTG -3'

Posted On

2014-08-25