Mutagenetix > Incidental Mutation

Incidental Mutation 'R1966:Ap2b1'

218981

Institutional Source

Beutler Lab

Gene Symbol

Ap2b1

Ensembl Gene

ENSMUSG00000035152

Gene Name

adaptor-related protein complex 2, beta 1 subunit

Synonyms

1300012O03Rik

MMRRC Submission

039979-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1966 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83299024-83405035 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 83346895 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 557 (I557T)

Ref Sequence

ENSEMBL: ENSMUSP00000135445 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523]

AlphaFold

Q9DBG3

Predicted Effect

probably benign
Transcript: ENSMUST00000018875
AA Change: I595T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: I595T

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	2.6e-173	PFAM
Pfam:HEAT_2	88	157	3.7e-8	PFAM
Pfam:Cnd1	99	268	2.1e-40	PFAM
Pfam:HEAT_2	124	219	1.4e-9	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	950	9.93e-56	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000065692
AA Change: I595T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: I595T

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4.2e-173	PFAM
Pfam:HEAT_2	88	157	2.7e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
Alpha_adaptinC2	707	817	2.94e-18	SMART
B2-adapt-app_C	826	936	9.93e-56	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132178

Predicted Effect

probably benign
Transcript: ENSMUST00000176430
AA Change: I595T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: I595T

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4e-173	PFAM
Pfam:HEAT_2	88	157	2.8e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	936	7.22e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000176523
AA Change: I557T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152
AA Change: I557T

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	95	1.1e-26	PFAM
Pfam:Cnd1	69	230	1.5e-26	PFAM
Pfam:HEAT_2	85	182	5.1e-9	PFAM
Pfam:Adaptin_N	90	496	4e-125	PFAM
low complexity region	587	605	N/A	INTRINSIC
low complexity region	616	637	N/A	INTRINSIC
Alpha_adaptinC2	683	793	2.94e-18	SMART
B2-adapt-app_C	802	912	9.93e-56	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810013L24Rik	A	G	16: 8,830,581	E41G	possibly damaging	Het
2410002F23Rik	T	A	7: 44,251,226	V185E	probably benign	Het
Abca1	A	C	4: 53,050,409	V1608G	probably damaging	Het
Arhgef15	G	T	11: 68,954,675	P117Q	probably damaging	Het
Arhgef39	T	C	4: 43,496,710	S335G	probably benign	Het
Blm	A	T	7: 80,513,186	F139Y	possibly damaging	Het
Cacna2d1	C	T	5: 16,333,785	R581*	probably null	Het
Cadps	C	A	14: 12,822,450	E97*	probably null	Het
Cavin2	T	A	1: 51,289,642	L86Q	probably damaging	Het
Ccdc136	A	G	6: 29,418,092	E787G	probably damaging	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Cdh23	T	C	10: 60,323,582	Y2138C	probably damaging	Het
Cdk12	T	A	11: 98,204,090	Y241*	probably null	Het
Clcn4	T	A	7: 7,284,185	*688L	probably null	Het
Cntnap1	T	C	11: 101,180,386	V375A	possibly damaging	Het
Coq5	T	A	5: 115,294,831		probably null	Het
Cyp4b1	A	G	4: 115,625,879	I405T	probably benign	Het
Det1	T	C	7: 78,843,218	Y346C	probably damaging	Het
Enpp3	A	T	10: 24,807,491	V276E	probably damaging	Het
Epb41l2	G	A	10: 25,441,768	R61Q	probably benign	Het
Fam76b	G	A	9: 13,828,066		probably null	Het
Fbxo45	A	T	16: 32,233,230	D238E	probably benign	Het
Fnip2	G	A	3: 79,493,472	T314I	probably benign	Het
Fsip2	T	C	2: 82,992,780	S6286P	possibly damaging	Het
Gbf1	T	C	19: 46,271,564	F999L	probably damaging	Het
Gm14139	T	A	2: 150,191,907	D49E	probably benign	Het
Gnao1	C	A	8: 93,944,199	T102K	probably benign	Het
Gpatch2	T	A	1: 187,322,301	D76E	probably damaging	Het
Gpd1l	A	G	9: 114,914,394	I146T	probably benign	Het
Grik2	A	T	10: 49,355,909	H508Q	probably damaging	Het
Hk3	A	T	13: 55,014,455	F112Y	probably damaging	Het
Hmcn2	T	G	2: 31,389,329	I1781S	probably damaging	Het
Inhba	A	T	13: 16,026,636	K261M	probably damaging	Het
Jarid2	T	A	13: 44,906,276	N661K	probably damaging	Het
Kcna2	T	C	3: 107,104,630	S176P	probably damaging	Het
Kcnj3	A	T	2: 55,437,331	Q44L	probably damaging	Het
Kcns1	G	T	2: 164,168,535	F101L	probably damaging	Het
Kdm5b	T	A	1: 134,613,873		probably null	Het
Klhl14	C	T	18: 21,554,673	G564D	probably damaging	Het
Klhl18	A	T	9: 110,476,590	V2E	probably benign	Het
Klhl6	T	C	16: 19,982,822	E61G	probably damaging	Het
Krt1	T	C	15: 101,848,992	D261G	probably benign	Het
Lama5	C	A	2: 180,188,352	C1896F	probably damaging	Het
Lrba	A	G	3: 86,605,868		probably null	Het
Lrch3	A	G	16: 32,914,385	T82A	possibly damaging	Het
Maml3	C	G	3: 52,104,139	G2A	unknown	Het
Mapkap1	T	A	2: 34,518,679	N34K	probably damaging	Het
Muc13	A	T	16: 33,814,539	I488F	probably damaging	Het
Muc5ac	A	G	7: 141,803,376	D1129G	possibly damaging	Het
Nacc1	A	T	8: 84,676,381	N288K	probably damaging	Het
Nek1	T	G	8: 61,016,296	I129R	probably damaging	Het
Nf1	T	A	11: 79,411,564	S319R	possibly damaging	Het
Nle1	C	T	11: 82,901,788	G432D	probably damaging	Het
Nol4l	A	G	2: 153,529,455	V103A	probably benign	Het
Oca2	A	G	7: 56,414,467	I737V	probably damaging	Het
Olfr1270	T	C	2: 90,149,404	S201G	probably damaging	Het
Olfr231	G	T	1: 174,117,251	S255*	probably null	Het
Olfr346	G	A	2: 36,688,784	V261I	probably benign	Het
Olfr358	A	T	2: 37,004,948	F222Y	possibly damaging	Het
Olfr630	G	T	7: 103,755,168	T139K	probably damaging	Het
Olfr655	A	G	7: 104,596,801	C127R	probably damaging	Het
Olfr750	T	A	14: 51,071,157	I79F	probably damaging	Het
Orc1	T	A	4: 108,612,217	I746N	probably damaging	Het
Pbxip1	A	G	3: 89,445,488	D147G	probably damaging	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Plin5	T	A	17: 56,112,186	D412V	probably damaging	Het
Plxna2	A	T	1: 194,644,700	Y314F	possibly damaging	Het
Ppid	A	T	3: 79,602,299	K308*	probably null	Het
Prss38	T	C	11: 59,373,484	Y219C	probably damaging	Het
Ptx3	C	T	3: 66,224,621	R188C	probably damaging	Het
Ralgds	T	A	2: 28,545,875	V504E	probably damaging	Het
Rere	T	C	4: 150,616,873	Y1237H	probably damaging	Het
Rpp30	C	T	19: 36,089,149	S94L	probably damaging	Het
Rrp15	C	T	1: 186,736,205	V205I	possibly damaging	Het
Scpep1	A	G	11: 88,952,414	W73R	probably damaging	Het
Sec23ip	A	G	7: 128,755,353	H376R	probably damaging	Het
Serping1	G	T	2: 84,765,728	T454K	probably damaging	Het
Shtn1	T	G	19: 58,975,038	Y615S	probably benign	Het
Slc20a2	C	A	8: 22,545,537	P184T	probably damaging	Het
Slc22a29	C	A	19: 8,218,408	R89L	probably damaging	Het
Slc2a2	A	G	3: 28,719,485	Q313R	probably damaging	Het
Tas2r122	A	T	6: 132,711,194	Y245*	probably null	Het
Ticrr	C	A	7: 79,694,735	C1449*	probably null	Het
Tmem181a	T	C	17: 6,303,226	V412A	probably benign	Het
Tmtc4	T	A	14: 122,927,599	E616V	probably benign	Het
Tnrc6b	A	G	15: 80,880,439	K714R	probably damaging	Het
Trpm8	T	A	1: 88,332,748		probably null	Het
Ubr2	T	C	17: 46,954,919	T1163A	probably benign	Het
Ubr4	A	G	4: 139,451,244		probably null	Het
Ulk2	A	T	11: 61,819,471		probably null	Het
Ulk4	T	A	9: 121,257,116	M350L	probably benign	Het
Vmn1r185	T	C	7: 26,611,531	E183G	probably benign	Het
Vmn1r76	T	A	7: 11,930,514	I223F	probably damaging	Het
Wdr27	T	C	17: 14,934,599	T19A	possibly damaging	Het
Wdr59	T	G	8: 111,450,903	T973P	possibly damaging	Het
Wnk2	A	G	13: 49,039,011	S664P	probably damaging	Het
Zfp120	A	T	2: 150,117,398	C335S	probably damaging	Het
Zfp30	C	A	7: 29,792,452	Q44K	probably benign	Het
Zfp541	T	C	7: 16,079,071	S550P	probably benign	Het
Zw10	C	A	9: 49,068,833	N421K	probably damaging	Het

Other mutations in Ap2b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Ap2b1	APN	11	83333158	missense	probably damaging	0.99
IGL01583:Ap2b1	APN	11	83324611	missense	possibly damaging	0.61
IGL01753:Ap2b1	APN	11	83321973	missense	probably damaging	1.00
IGL01992:Ap2b1	APN	11	83335530	missense	probably damaging	1.00
IGL02192:Ap2b1	APN	11	83346766	missense	possibly damaging	0.48
IGL02315:Ap2b1	APN	11	83336799	missense	probably damaging	0.96
IGL03235:Ap2b1	APN	11	83341384	missense	probably benign	0.41
P0045:Ap2b1	UTSW	11	83368026	missense	probably damaging	1.00
R0121:Ap2b1	UTSW	11	83321967	missense	possibly damaging	0.66
R0334:Ap2b1	UTSW	11	83367874	splice site	probably benign
R1222:Ap2b1	UTSW	11	83346738	missense	probably benign	0.06
R1297:Ap2b1	UTSW	11	83333109	missense	probably damaging	1.00
R1653:Ap2b1	UTSW	11	83346831	missense	probably damaging	1.00
R1719:Ap2b1	UTSW	11	83324604	missense	probably damaging	1.00
R1885:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1886:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1965:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R2046:Ap2b1	UTSW	11	83336386	missense	probably benign	0.14
R2086:Ap2b1	UTSW	11	83351118	missense	possibly damaging	0.88
R2132:Ap2b1	UTSW	11	83324761	splice site	probably benign
R3615:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3616:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3983:Ap2b1	UTSW	11	83390716	missense	probably damaging	1.00
R4124:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4125:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4198:Ap2b1	UTSW	11	83342603	missense	probably damaging	1.00
R4202:Ap2b1	UTSW	11	83335604	critical splice donor site	probably null
R4543:Ap2b1	UTSW	11	83324650	missense	probably damaging	1.00
R4583:Ap2b1	UTSW	11	83397779	missense	probably benign	0.00
R4589:Ap2b1	UTSW	11	83333011	nonsense	probably null
R4916:Ap2b1	UTSW	11	83390706	missense	probably damaging	1.00
R5005:Ap2b1	UTSW	11	83339392	missense	probably damaging	1.00
R5385:Ap2b1	UTSW	11	83342601	missense	probably damaging	1.00
R5510:Ap2b1	UTSW	11	83336737	splice site	probably null
R5738:Ap2b1	UTSW	11	83336430	splice site	probably null
R6023:Ap2b1	UTSW	11	83335398	missense	probably damaging	0.99
R6269:Ap2b1	UTSW	11	83346673	missense	probably damaging	1.00
R6383:Ap2b1	UTSW	11	83346825	missense	probably damaging	1.00
R6416:Ap2b1	UTSW	11	83308239	start codon destroyed	probably null	1.00
R6502:Ap2b1	UTSW	11	83342679	missense	probably damaging	0.97
R6810:Ap2b1	UTSW	11	83335491	missense	possibly damaging	0.89
R6969:Ap2b1	UTSW	11	83389726	missense	probably damaging	0.99
R7238:Ap2b1	UTSW	11	83333122	missense	possibly damaging	0.91
R7241:Ap2b1	UTSW	11	83351105	missense	probably benign	0.16
R7429:Ap2b1	UTSW	11	83367998	missense	probably benign	0.00
R7588:Ap2b1	UTSW	11	83324522	missense	probably benign	0.00
R7635:Ap2b1	UTSW	11	83389728	missense	probably benign	0.09
R7651:Ap2b1	UTSW	11	83339430	critical splice donor site	probably null
R7753:Ap2b1	UTSW	11	83367907	nonsense	probably null
R8468:Ap2b1	UTSW	11	83351065	missense	probably damaging	1.00
R8943:Ap2b1	UTSW	11	83346753	missense	probably damaging	1.00
R9093:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
R9621:Ap2b1	UTSW	11	83402598	missense	probably damaging	1.00
X0064:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
Z1177:Ap2b1	UTSW	11	83365753	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AAGTGGTGTTGTCTGAGAAGCC -3'
(R):5'- TACCAGGGACTTAAGCAACTTC -3'

Sequencing Primer
(F):5'- CTGAGAAGCCATTGATCTCTGAG -3'
(R):5'- GGGACTTAAGCAACTTCCAAAC -3'

Posted On

2014-08-25