Incidental Mutation 'R0135:Vipr2'
ID21904
Institutional Source Beutler Lab
Gene Symbol Vipr2
Ensembl Gene ENSMUSG00000011171
Gene Namevasoactive intestinal peptide receptor 2
SynonymsVPAC2R, VPAC2, VIP receptor subtype 2, Vip2
MMRRC Submission 038420-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R0135 (G1)
Quality Score225
Status Validated (trace)
Chromosome12
Chromosomal Location116077726-116146261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116142827 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 348 (I348V)
Ref Sequence ENSEMBL: ENSMUSP00000011315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011315]
Predicted Effect probably benign
Transcript: ENSMUST00000011315
AA Change: I348V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000011315
Gene: ENSMUSG00000011171
AA Change: I348V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
HormR 47 117 8.35e-25 SMART
Pfam:7tm_2 122 370 1.5e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176078
Predicted Effect unknown
Transcript: ENSMUST00000176433
AA Change: I88V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177059
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for vasoactive intestinal peptide, a small neuropeptide. Vasoactive intestinal peptide is involved in smooth muscle relaxation, exocrine and endocrine secretion, and water and ion flux in lung and intestinal epithelia. Its actions are effected through integral membrane receptors associated with a guanine nucleotide binding protein which activates adenylate cyclase. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit enhanced delayed-type hypersensitivity (type IV) and reduced immediate-type hypersensitivity (type I). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T C 7: 34,245,957 I499M probably damaging Het
4932438H23Rik A G 16: 91,055,627 F207S probably damaging Het
Abhd8 T A 8: 71,458,074 K363N probably benign Het
Adam11 T A 11: 102,776,573 V653E probably damaging Het
Adam18 T C 8: 24,665,542 S154G possibly damaging Het
Adamts1 T C 16: 85,798,703 probably benign Het
Afm G T 5: 90,550,322 V528L probably benign Het
Alox12b C T 11: 69,162,748 H145Y probably benign Het
Ankmy2 C A 12: 36,170,435 probably benign Het
Aox3 G A 1: 58,125,088 probably benign Het
Arhgap28 T C 17: 67,864,588 D396G probably damaging Het
B430203G13Rik T C 12: 17,924,488 noncoding transcript Het
Bean1 C T 8: 104,217,175 P121S probably damaging Het
Bok T C 1: 93,686,507 S21P probably damaging Het
Brwd1 A C 16: 96,047,104 N572K probably damaging Het
C5ar1 A T 7: 16,248,939 V52E probably damaging Het
Cdr2l C A 11: 115,393,671 P278T probably damaging Het
Cnga4 T A 7: 105,406,848 I219N probably damaging Het
Cpne2 C T 8: 94,554,925 probably benign Het
D430041D05Rik A G 2: 104,255,034 S1057P possibly damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dgcr2 A G 16: 17,858,442 S152P probably damaging Het
Dstyk A T 1: 132,462,934 D828V probably damaging Het
Eml2 T C 7: 19,203,952 S582P probably damaging Het
Engase T C 11: 118,484,478 Y359H possibly damaging Het
Fat3 T C 9: 16,006,777 D1450G probably damaging Het
Fbxw8 A T 5: 118,070,487 I467N probably damaging Het
Fhdc1 A T 3: 84,445,618 Y767N probably damaging Het
Flii T C 11: 60,723,378 D105G probably damaging Het
Gaa C T 11: 119,278,890 T590I probably benign Het
Gabrr1 T A 4: 33,160,224 S303T probably damaging Het
Gif G T 19: 11,757,754 C246F probably damaging Het
Glp1r A G 17: 30,924,577 I196V probably benign Het
Gm884 C A 11: 103,618,047 probably benign Het
Grm6 G A 11: 50,853,223 E174K probably damaging Het
Helz2 A C 2: 181,232,269 L2144R probably damaging Het
Itpr1 A T 6: 108,488,482 probably benign Het
Kcns1 A T 2: 164,164,955 S363T possibly damaging Het
Kif13a A T 13: 46,793,943 V855E probably damaging Het
Krt42 T C 11: 100,263,159 T424A possibly damaging Het
Lct A T 1: 128,285,123 F1931Y probably damaging Het
Lrp1b A T 2: 41,269,239 V1563E probably damaging Het
Lzts2 T C 19: 45,026,187 probably benign Het
Mamdc4 C T 2: 25,566,920 R615Q possibly damaging Het
Mei1 C T 15: 82,071,969 Q133* probably null Het
Mif4gd T C 11: 115,608,465 E197G probably damaging Het
Ncdn A T 4: 126,746,669 S544T probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Olfr68 T A 7: 103,777,763 D194V probably damaging Het
Padi6 T C 4: 140,737,352 T114A probably benign Het
Pigk G T 3: 152,744,706 probably benign Het
Pkd1 T A 17: 24,565,071 F197Y possibly damaging Het
Pld5 A T 1: 175,970,589 F415I probably damaging Het
Pnpla5 A G 15: 84,113,949 L364P probably damaging Het
Prrc2c G A 1: 162,715,483 probably benign Het
Rab32 C T 10: 10,550,840 D121N probably damaging Het
Rab44 A T 17: 29,138,132 T79S probably benign Het
Reln G T 5: 22,128,649 N258K probably damaging Het
Retsat A G 6: 72,602,772 T177A probably damaging Het
Serpinf2 T A 11: 75,436,393 H236L probably damaging Het
Slc26a6 A T 9: 108,860,595 probably benign Het
Slitrk1 T A 14: 108,911,629 E550V probably benign Het
Smarcd3 A T 5: 24,595,499 probably benign Het
Spdye4a A C 5: 143,225,102 probably null Het
Susd2 C T 10: 75,638,514 G572D probably damaging Het
Tcaf3 C T 6: 42,589,758 R799K probably benign Het
Tg A G 15: 66,694,870 S1256G probably benign Het
Them4 A T 3: 94,323,570 probably benign Het
Tmem210 C T 2: 25,288,468 A47V probably damaging Het
Tnfrsf1b A G 4: 145,229,046 Y47H probably benign Het
Tnik T G 3: 28,607,245 N598K possibly damaging Het
Ttc3 A G 16: 94,462,268 N1498D possibly damaging Het
Ttll4 C A 1: 74,679,928 H313N possibly damaging Het
Vps13a A G 19: 16,780,765 V2A probably damaging Het
Vps72 G A 3: 95,119,197 R151K probably damaging Het
Zfp106 A G 2: 120,520,487 V1561A probably damaging Het
Zfp658 C A 7: 43,573,595 Y431* probably null Het
Zkscan2 T C 7: 123,480,641 K698E possibly damaging Het
Other mutations in Vipr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Vipr2 APN 12 116138748 splice site probably null
IGL02233:Vipr2 APN 12 116094736 missense probably damaging 0.99
IGL02691:Vipr2 APN 12 116136229 missense probably benign 0.11
PIT4377001:Vipr2 UTSW 12 116094798 missense probably benign 0.01
R0207:Vipr2 UTSW 12 116142882 missense probably damaging 1.00
R1389:Vipr2 UTSW 12 116137330 missense probably benign 0.01
R1560:Vipr2 UTSW 12 116094781 missense probably benign 0.18
R1575:Vipr2 UTSW 12 116144272 missense probably benign
R1696:Vipr2 UTSW 12 116139157 missense probably benign 0.13
R1970:Vipr2 UTSW 12 116136206 missense probably benign 0.01
R2010:Vipr2 UTSW 12 116122810 critical splice donor site probably null
R3873:Vipr2 UTSW 12 116136104 unclassified probably benign
R4713:Vipr2 UTSW 12 116080131 missense probably benign 0.00
R4953:Vipr2 UTSW 12 116144256 missense probably benign 0.07
R6041:Vipr2 UTSW 12 116142984 missense probably damaging 1.00
R6337:Vipr2 UTSW 12 116122743 nonsense probably null
R6902:Vipr2 UTSW 12 116139199 missense possibly damaging 0.46
R6946:Vipr2 UTSW 12 116139199 missense possibly damaging 0.46
X0066:Vipr2 UTSW 12 116142945 splice site probably null
X0067:Vipr2 UTSW 12 116139172 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATTCTGCCCAAGCGTGCAAAG -3'
(R):5'- TGACCCAACGTCAGTGCCAAATTC -3'

Sequencing Primer
(F):5'- AAGCGGGTTCACAGGCAC -3'
(R):5'- AGCTGACAAAGGACTTACCTC -3'
Posted On2013-04-12