Incidental Mutation 'R1967:Kcng4'
ID219068
Institutional Source Beutler Lab
Gene Symbol Kcng4
Ensembl Gene ENSMUSG00000045246
Gene Namepotassium voltage-gated channel, subfamily G, member 4
SynonymsKV6.4, 4921535I01Rik, KV6.3
MMRRC Submission 039980-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1967 (G1)
Quality Score111
Status Not validated
Chromosome8
Chromosomal Location119623854-119635680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119632923 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 238 (V238A)
Ref Sequence ENSEMBL: ENSMUSP00000129687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061828] [ENSMUST00000164382]
Predicted Effect probably damaging
Transcript: ENSMUST00000061828
AA Change: V238A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000056552
Gene: ENSMUSG00000045246
AA Change: V238A

DomainStartEndE-ValueType
BTB 58 168 7.13e-3 SMART
Pfam:Ion_trans 218 462 1.2e-40 PFAM
Pfam:Ion_trans_2 370 457 7e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164382
AA Change: V238A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129687
Gene: ENSMUSG00000045246
AA Change: V238A

DomainStartEndE-ValueType
BTB 58 168 7.13e-3 SMART
Pfam:Ion_trans 262 451 6.6e-29 PFAM
Pfam:Ion_trans_2 371 457 1.7e-13 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily G. This member functions as a modulatory subunit. The gene has strong expression in brain. Multiple alternatively spliced variants have been found in normal and cancerous tissues. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T G 15: 8,203,420 V1141G probably benign Het
4930447A16Rik A C 15: 37,439,598 probably benign Het
4931408C20Rik T A 1: 26,683,373 I909L probably benign Het
Abca6 T C 11: 110,187,148 I1278V probably benign Het
Adamts15 C T 9: 30,921,309 W310* probably null Het
Adamts6 T A 13: 104,426,951 C650* probably null Het
Akap3 G T 6: 126,865,098 G227C probably benign Het
Alox12e A T 11: 70,317,856 S457T probably benign Het
Angpt1 C A 15: 42,438,307 C435F probably damaging Het
Anxa9 T C 3: 95,300,608 Q207R probably benign Het
Aplnr A T 2: 85,137,606 D325V probably benign Het
Art2b A C 7: 101,580,207 F162V probably damaging Het
Atp13a4 A G 16: 29,479,854 S96P probably damaging Het
Bnc1 A T 7: 81,973,636 H614Q probably benign Het
C6 A G 15: 4,759,820 D249G probably damaging Het
Camta1 A T 4: 151,088,973 F977I probably damaging Het
Chil6 T C 3: 106,391,154 S188G possibly damaging Het
Cntrob A T 11: 69,320,963 L145Q probably damaging Het
Coro7 T C 16: 4,634,889 E306G probably damaging Het
Cpq T C 15: 33,497,202 S363P possibly damaging Het
Ctc1 A G 11: 69,027,862 probably null Het
Defb43 T A 14: 63,017,797 N26K probably benign Het
Dennd1a T C 2: 37,844,833 T41A probably benign Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Eml6 A G 11: 30,024,545 L11P probably damaging Het
Epha5 A G 5: 84,416,429 V26A probably benign Het
Fam13c A G 10: 70,551,735 D443G probably damaging Het
Fam227a G A 15: 79,637,134 L243F possibly damaging Het
Fat3 T G 9: 15,968,295 R3301S probably benign Het
Fbxw20 T C 9: 109,217,510 T461A probably benign Het
Fgf8 T A 19: 45,741,568 S61C probably damaging Het
Fgfrl1 A G 5: 108,705,005 E100G probably damaging Het
Gabra4 G A 5: 71,572,069 S456F possibly damaging Het
Gas6 T C 8: 13,470,317 E457G probably damaging Het
Gm156 A T 6: 129,775,835 N2K possibly damaging Het
Gpr33 G A 12: 52,024,208 S16L probably benign Het
Greb1l A C 18: 10,501,049 N393T possibly damaging Het
Gtpbp4 T C 13: 8,977,304 K492E probably benign Het
Hsf2bp A T 17: 31,987,404 L251* probably null Het
Hyal5 A T 6: 24,876,194 Q22L possibly damaging Het
Itih1 A T 14: 30,941,984 V114E possibly damaging Het
Jak3 T A 8: 71,681,535 I427N probably damaging Het
Jcad T C 18: 4,675,162 S975P probably benign Het
Klb A G 5: 65,372,074 D315G probably damaging Het
Krt5 T C 15: 101,711,659 N208D probably benign Het
Lmo7 T A 14: 101,900,215 H551Q probably benign Het
Lrp8 G T 4: 107,859,971 G732V probably damaging Het
Lrrc38 A G 4: 143,369,983 D288G unknown Het
Lrrc4b GAGAAG GAG 7: 44,462,230 probably benign Het
Mas1 A G 17: 12,842,036 Y167H probably benign Het
Mcm8 A C 2: 132,842,742 I759L probably benign Het
Med13l G A 5: 118,761,322 D2148N probably damaging Het
Muc20 A T 16: 32,794,242 I255K probably benign Het
Myh1 A G 11: 67,213,447 N980S probably benign Het
Nap1l4 T A 7: 143,534,287 Q178L probably damaging Het
Ncapg T A 5: 45,699,910 L988Q probably damaging Het
Ncf2 A T 1: 152,830,372 H245L probably damaging Het
Neurl4 A G 11: 69,903,210 E164G possibly damaging Het
Nf1 G A 11: 79,412,745 R416H probably damaging Het
Obscn G A 11: 59,135,709 Q223* probably null Het
Olfr1394 T C 11: 49,160,848 I278T probably benign Het
Olfr1494 T A 19: 13,750,053 *316R probably null Het
Pcdhb16 T A 18: 37,479,662 N558K probably damaging Het
Pcnx2 A T 8: 125,815,683 M1253K possibly damaging Het
Pla2g4a A G 1: 149,922,081 V22A probably damaging Het
Plppr5 G A 3: 117,625,906 probably null Het
Pnpla2 T C 7: 141,459,432 S353P probably benign Het
Pom121 A T 5: 135,391,754 L271Q unknown Het
Prepl A T 17: 85,088,551 M1K probably null Het
Prr14l A G 5: 32,844,469 probably benign Het
Psmc3 C A 2: 91,057,844 P325T probably benign Het
Psme2b A G 11: 48,946,069 V17A probably damaging Het
Ptpro A G 6: 137,416,865 I23V probably benign Het
Rab31 A G 17: 65,772,504 probably null Het
Ranbp6 T A 19: 29,812,500 K151* probably null Het
Rbm12b1 A T 4: 12,146,304 I759L probably benign Het
Rgs5 T C 1: 169,676,856 I25T probably benign Het
Rnf213 T C 11: 119,480,895 V4842A probably damaging Het
Rtl9 A T X: 143,103,041 I1150F probably damaging Het
Scn1a A T 2: 66,328,425 W384R probably damaging Het
Sema5a C T 15: 32,681,619 P948L probably damaging Het
Slc26a3 G A 12: 31,465,778 R559Q probably damaging Het
Slc29a3 A G 10: 60,716,464 V267A probably benign Het
Spata22 A G 11: 73,331,127 probably benign Het
Sptbn2 G T 19: 4,745,299 R1595L probably benign Het
Tfdp1 T C 8: 13,373,039 S315P possibly damaging Het
Tle1 A T 4: 72,120,226 V688E probably damaging Het
Tmem129 A T 5: 33,655,321 probably null Het
Tmprss11a G A 5: 86,431,843 T91I probably benign Het
Tnfsf14 A G 17: 57,190,807 Y142H probably damaging Het
Tph1 T C 7: 46,662,114 D68G probably benign Het
Ttn A T 2: 76,762,287 S12507T probably damaging Het
Tubgcp2 T A 7: 140,006,153 M408L probably benign Het
Usp34 A T 11: 23,364,503 H815L probably benign Het
Usp6nl G A 2: 6,441,519 R746H probably benign Het
Utp20 A G 10: 88,816,979 S358P probably benign Het
Vmn2r118 G A 17: 55,592,882 T674I probably damaging Het
Vmn2r8 A T 5: 108,802,383 H199Q probably benign Het
Vmn2r9 A G 5: 108,847,522 V420A probably benign Het
Vmn2r99 A T 17: 19,378,815 T254S probably benign Het
Zbed5 A G 5: 129,901,669 H132R possibly damaging Het
Zfp568 A G 7: 29,989,088 E25G probably damaging Het
Zfp951 T A 5: 104,817,000 I67L possibly damaging Het
Other mutations in Kcng4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Kcng4 APN 8 119626331 missense probably benign 0.00
IGL01360:Kcng4 APN 8 119625677 missense probably benign 0.40
IGL02094:Kcng4 APN 8 119633221 missense probably damaging 0.98
IGL02205:Kcng4 APN 8 119626083 missense probably damaging 0.99
IGL02892:Kcng4 APN 8 119633082 missense probably benign
IGL02927:Kcng4 APN 8 119626322 missense probably benign
IGL02954:Kcng4 APN 8 119633053 missense probably benign
IGL03143:Kcng4 APN 8 119625770 missense probably damaging 1.00
FR4449:Kcng4 UTSW 8 119633519 nonsense probably null
FR4548:Kcng4 UTSW 8 119633519 nonsense probably null
FR4737:Kcng4 UTSW 8 119633519 nonsense probably null
FR4976:Kcng4 UTSW 8 119633519 nonsense probably null
LCD18:Kcng4 UTSW 8 119633519 nonsense probably null
R0017:Kcng4 UTSW 8 119633520 missense probably damaging 1.00
R1777:Kcng4 UTSW 8 119633487 missense probably benign 0.02
R1852:Kcng4 UTSW 8 119626208 missense probably benign 0.01
R3886:Kcng4 UTSW 8 119633247 missense probably benign 0.34
R4009:Kcng4 UTSW 8 119626085 missense probably damaging 1.00
R5137:Kcng4 UTSW 8 119625878 missense possibly damaging 0.88
R5792:Kcng4 UTSW 8 119626279 missense probably damaging 1.00
R5987:Kcng4 UTSW 8 119626359 missense probably damaging 1.00
R6339:Kcng4 UTSW 8 119632954 missense probably damaging 1.00
R6379:Kcng4 UTSW 8 119633620 nonsense probably null
R6430:Kcng4 UTSW 8 119633050 missense probably damaging 0.96
X0024:Kcng4 UTSW 8 119633367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACTTTAGGGCTGCCAGGG -3'
(R):5'- CATCGAGGAAACCAACCTGG -3'

Sequencing Primer
(F):5'- CCCAGCCAGTAACACTAGGG -3'
(R):5'- GAAACCAACCTGGAGCGCTG -3'
Posted On2014-08-25