Mutagenetix > Incidental Mutations

Incidental Mutation 'R1967:Slc29a3'

219075

Institutional Source

Beutler Lab

Gene Symbol

Slc29a3

Ensembl Gene

ENSMUSG00000020100

Gene Name

solute carrier family 29 (nucleoside transporters), member 3

Synonyms

4933435C21Rik, Ent3

MMRRC Submission

039980-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.089) question?

Stock #

R1967 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

60712072-60752794 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 60716464 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 267 (V267A)

Ref Sequence

ENSEMBL: ENSMUSP00000112685 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117513] [ENSMUST00000119595] [ENSMUST00000150845]

Predicted Effect

probably benign
Transcript: ENSMUST00000117513
AA Change: V267A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000112685
Gene: ENSMUSG00000020100
AA Change: V267A

Domain	Start	End	E-Value	Type
transmembrane domain	50	72	N/A	INTRINSIC
transmembrane domain	107	126	N/A	INTRINSIC
transmembrane domain	133	155	N/A	INTRINSIC
Pfam:Nucleoside_tran	169	473	2.2e-62	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000119595

SMART Domains

Protein: ENSMUSP00000112426
Gene: ENSMUSG00000020100

Domain	Start	End	E-Value	Type
transmembrane domain	50	72	N/A	INTRINSIC
transmembrane domain	107	126	N/A	INTRINSIC
transmembrane domain	133	155	N/A	INTRINSIC
transmembrane domain	165	187	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127386

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144989

Predicted Effect

probably benign
Transcript: ENSMUST00000150845

SMART Domains

Protein: ENSMUSP00000119716
Gene: ENSMUSG00000020100

Domain	Start	End	E-Value	Type
transmembrane domain	50	72	N/A	INTRINSIC
low complexity region	117	125	N/A	INTRINSIC
low complexity region	144	155	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleoside transporter. The encoded protein plays a role in cellular uptake of nucleosides, nucleobases, and their related analogs. Mutations in this gene have been associated with H syndrome, which is characterized by cutaneous hyperpigmentation and hypertrichosis, hepatosplenomegaly, heart anomalies, and hypogonadism. A related disorder, PHID (pigmented hypertrichosis with insulin-dependent diabetes mellitus), has also been associated with mutations at this locus. Alternatively spliced transcript variants have been described.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lymphadenopathy, splenomegaly, histiocytic sarcoma, and premature death associated with extramedullary hematopoiesis, increased macrophage proliferation and apoptosis and abnormal lysosome function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	G	15: 8,203,420	V1141G	probably benign	Het
4930447A16Rik	A	C	15: 37,439,598		probably benign	Het
4931408C20Rik	T	A	1: 26,683,373	I909L	probably benign	Het
Abca6	T	C	11: 110,187,148	I1278V	probably benign	Het
Adamts15	C	T	9: 30,921,309	W310*	probably null	Het
Adamts6	T	A	13: 104,426,951	C650*	probably null	Het
Akap3	G	T	6: 126,865,098	G227C	probably benign	Het
Alox12e	A	T	11: 70,317,856	S457T	probably benign	Het
Angpt1	C	A	15: 42,438,307	C435F	probably damaging	Het
Anxa9	T	C	3: 95,300,608	Q207R	probably benign	Het
Aplnr	A	T	2: 85,137,606	D325V	probably benign	Het
Art2b	A	C	7: 101,580,207	F162V	probably damaging	Het
Atp13a4	A	G	16: 29,479,854	S96P	probably damaging	Het
Bnc1	A	T	7: 81,973,636	H614Q	probably benign	Het
C6	A	G	15: 4,759,820	D249G	probably damaging	Het
Camta1	A	T	4: 151,088,973	F977I	probably damaging	Het
Chil6	T	C	3: 106,391,154	S188G	possibly damaging	Het
Cntrob	A	T	11: 69,320,963	L145Q	probably damaging	Het
Coro7	T	C	16: 4,634,889	E306G	probably damaging	Het
Cpq	T	C	15: 33,497,202	S363P	possibly damaging	Het
Ctc1	A	G	11: 69,027,862		probably null	Het
Defb43	T	A	14: 63,017,797	N26K	probably benign	Het
Dennd1a	T	C	2: 37,844,833	T41A	probably benign	Het
Dnah11	A	C	12: 117,916,788	Y3866D	probably damaging	Het
Eml6	A	G	11: 30,024,545	L11P	probably damaging	Het
Epha5	A	G	5: 84,416,429	V26A	probably benign	Het
Fam13c	A	G	10: 70,551,735	D443G	probably damaging	Het
Fam227a	G	A	15: 79,637,134	L243F	possibly damaging	Het
Fat3	T	G	9: 15,968,295	R3301S	probably benign	Het
Fbxw20	T	C	9: 109,217,510	T461A	probably benign	Het
Fgf8	T	A	19: 45,741,568	S61C	probably damaging	Het
Fgfrl1	A	G	5: 108,705,005	E100G	probably damaging	Het
Gabra4	G	A	5: 71,572,069	S456F	possibly damaging	Het
Gas6	T	C	8: 13,470,317	E457G	probably damaging	Het
Gm156	A	T	6: 129,775,835	N2K	possibly damaging	Het
Gpr33	G	A	12: 52,024,208	S16L	probably benign	Het
Greb1l	A	C	18: 10,501,049	N393T	possibly damaging	Het
Gtpbp4	T	C	13: 8,977,304	K492E	probably benign	Het
Hsf2bp	A	T	17: 31,987,404	L251*	probably null	Het
Hyal5	A	T	6: 24,876,194	Q22L	possibly damaging	Het
Itih1	A	T	14: 30,941,984	V114E	possibly damaging	Het
Jak3	T	A	8: 71,681,535	I427N	probably damaging	Het
Jcad	T	C	18: 4,675,162	S975P	probably benign	Het
Kcng4	A	G	8: 119,632,923	V238A	probably damaging	Het
Klb	A	G	5: 65,372,074	D315G	probably damaging	Het
Krt5	T	C	15: 101,711,659	N208D	probably benign	Het
Lmo7	T	A	14: 101,900,215	H551Q	probably benign	Het
Lrp8	G	T	4: 107,859,971	G732V	probably damaging	Het
Lrrc38	A	G	4: 143,369,983	D288G	unknown	Het
Lrrc4b	GAGAAG	GAG	7: 44,462,230		probably benign	Het
Mas1	A	G	17: 12,842,036	Y167H	probably benign	Het
Mcm8	A	C	2: 132,842,742	I759L	probably benign	Het
Med13l	G	A	5: 118,761,322	D2148N	probably damaging	Het
Muc20	A	T	16: 32,794,242	I255K	probably benign	Het
Myh1	A	G	11: 67,213,447	N980S	probably benign	Het
Nap1l4	T	A	7: 143,534,287	Q178L	probably damaging	Het
Ncapg	T	A	5: 45,699,910	L988Q	probably damaging	Het
Ncf2	A	T	1: 152,830,372	H245L	probably damaging	Het
Neurl4	A	G	11: 69,903,210	E164G	possibly damaging	Het
Nf1	G	A	11: 79,412,745	R416H	probably damaging	Het
Obscn	G	A	11: 59,135,709	Q223*	probably null	Het
Olfr1394	T	C	11: 49,160,848	I278T	probably benign	Het
Olfr1494	T	A	19: 13,750,053	*316R	probably null	Het
Pcdhb16	T	A	18: 37,479,662	N558K	probably damaging	Het
Pcnx2	A	T	8: 125,815,683	M1253K	possibly damaging	Het
Pla2g4a	A	G	1: 149,922,081	V22A	probably damaging	Het
Plppr5	G	A	3: 117,625,906		probably null	Het
Pnpla2	T	C	7: 141,459,432	S353P	probably benign	Het
Pom121	A	T	5: 135,391,754	L271Q	unknown	Het
Prepl	A	T	17: 85,088,551	M1K	probably null	Het
Prr14l	A	G	5: 32,844,469		probably benign	Het
Psmc3	C	A	2: 91,057,844	P325T	probably benign	Het
Psme2b	A	G	11: 48,946,069	V17A	probably damaging	Het
Ptpro	A	G	6: 137,416,865	I23V	probably benign	Het
Rab31	A	G	17: 65,772,504		probably null	Het
Ranbp6	T	A	19: 29,812,500	K151*	probably null	Het
Rbm12b1	A	T	4: 12,146,304	I759L	probably benign	Het
Rgs5	T	C	1: 169,676,856	I25T	probably benign	Het
Rnf213	T	C	11: 119,480,895	V4842A	probably damaging	Het
Rtl9	A	T	X: 143,103,041	I1150F	probably damaging	Het
Scn1a	A	T	2: 66,328,425	W384R	probably damaging	Het
Sema5a	C	T	15: 32,681,619	P948L	probably damaging	Het
Slc26a3	G	A	12: 31,465,778	R559Q	probably damaging	Het
Spata22	A	G	11: 73,331,127		probably benign	Het
Sptbn2	G	T	19: 4,745,299	R1595L	probably benign	Het
Tfdp1	T	C	8: 13,373,039	S315P	possibly damaging	Het
Tle1	A	T	4: 72,120,226	V688E	probably damaging	Het
Tmem129	A	T	5: 33,655,321		probably null	Het
Tmprss11a	G	A	5: 86,431,843	T91I	probably benign	Het
Tnfsf14	A	G	17: 57,190,807	Y142H	probably damaging	Het
Tph1	T	C	7: 46,662,114	D68G	probably benign	Het
Ttn	A	T	2: 76,762,287	S12507T	probably damaging	Het
Tubgcp2	T	A	7: 140,006,153	M408L	probably benign	Het
Usp34	A	T	11: 23,364,503	H815L	probably benign	Het
Usp6nl	G	A	2: 6,441,519	R746H	probably benign	Het
Utp20	A	G	10: 88,816,979	S358P	probably benign	Het
Vmn2r118	G	A	17: 55,592,882	T674I	probably damaging	Het
Vmn2r8	A	T	5: 108,802,383	H199Q	probably benign	Het
Vmn2r9	A	G	5: 108,847,522	V420A	probably benign	Het
Vmn2r99	A	T	17: 19,378,815	T254S	probably benign	Het
Zbed5	A	G	5: 129,901,669	H132R	possibly damaging	Het
Zfp568	A	G	7: 29,989,088	E25G	probably damaging	Het
Zfp951	T	A	5: 104,817,000	I67L	possibly damaging	Het

Other mutations in Slc29a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01475:Slc29a3	APN	10	60723817	missense	possibly damaging	0.95
R1986:Slc29a3	UTSW	10	60723814	missense	probably damaging	1.00
R2206:Slc29a3	UTSW	10	60715907	missense	possibly damaging	0.87
R3891:Slc29a3	UTSW	10	60716261	nonsense	probably null
R4734:Slc29a3	UTSW	10	60716326	missense	probably benign	0.01
R4748:Slc29a3	UTSW	10	60716326	missense	probably benign	0.01
R4749:Slc29a3	UTSW	10	60716326	missense	probably benign	0.01
R5682:Slc29a3	UTSW	10	60716212	missense	probably benign	0.00
R5938:Slc29a3	UTSW	10	60752784	unclassified	probably benign
R6104:Slc29a3	UTSW	10	60721002	missense	possibly damaging	0.77
R6405:Slc29a3	UTSW	10	60716026	missense	probably damaging	0.98
R7341:Slc29a3	UTSW	10	60750658	missense	probably benign	0.25
R7683:Slc29a3	UTSW	10	60716366	missense	not run
RF009:Slc29a3	UTSW	10	60750561	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AAGAACTTGGAGGTCCATGG -3'
(R):5'- ATCCTGGGCTTAGAGGTTCC -3'

Sequencing Primer
(F):5'- CTTGGAGGTCCATGGAGAGC -3'
(R):5'- CAGGGCTTGGACTTTGCC -3'

Posted On

2014-08-25