Incidental Mutation 'R1967:Slc29a3'
ID219075
Institutional Source Beutler Lab
Gene Symbol Slc29a3
Ensembl Gene ENSMUSG00000020100
Gene Namesolute carrier family 29 (nucleoside transporters), member 3
Synonyms4933435C21Rik, Ent3
MMRRC Submission 039980-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R1967 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location60712072-60752794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60716464 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 267 (V267A)
Ref Sequence ENSEMBL: ENSMUSP00000112685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117513] [ENSMUST00000119595] [ENSMUST00000150845]
Predicted Effect probably benign
Transcript: ENSMUST00000117513
AA Change: V267A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112685
Gene: ENSMUSG00000020100
AA Change: V267A

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 107 126 N/A INTRINSIC
transmembrane domain 133 155 N/A INTRINSIC
Pfam:Nucleoside_tran 169 473 2.2e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119595
SMART Domains Protein: ENSMUSP00000112426
Gene: ENSMUSG00000020100

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 107 126 N/A INTRINSIC
transmembrane domain 133 155 N/A INTRINSIC
transmembrane domain 165 187 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144989
Predicted Effect probably benign
Transcript: ENSMUST00000150845
SMART Domains Protein: ENSMUSP00000119716
Gene: ENSMUSG00000020100

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 117 125 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleoside transporter. The encoded protein plays a role in cellular uptake of nucleosides, nucleobases, and their related analogs. Mutations in this gene have been associated with H syndrome, which is characterized by cutaneous hyperpigmentation and hypertrichosis, hepatosplenomegaly, heart anomalies, and hypogonadism. A related disorder, PHID (pigmented hypertrichosis with insulin-dependent diabetes mellitus), has also been associated with mutations at this locus. Alternatively spliced transcript variants have been described.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lymphadenopathy, splenomegaly, histiocytic sarcoma, and premature death associated with extramedullary hematopoiesis, increased macrophage proliferation and apoptosis and abnormal lysosome function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T G 15: 8,203,420 V1141G probably benign Het
4930447A16Rik A C 15: 37,439,598 probably benign Het
4931408C20Rik T A 1: 26,683,373 I909L probably benign Het
Abca6 T C 11: 110,187,148 I1278V probably benign Het
Adamts15 C T 9: 30,921,309 W310* probably null Het
Adamts6 T A 13: 104,426,951 C650* probably null Het
Akap3 G T 6: 126,865,098 G227C probably benign Het
Alox12e A T 11: 70,317,856 S457T probably benign Het
Angpt1 C A 15: 42,438,307 C435F probably damaging Het
Anxa9 T C 3: 95,300,608 Q207R probably benign Het
Aplnr A T 2: 85,137,606 D325V probably benign Het
Art2b A C 7: 101,580,207 F162V probably damaging Het
Atp13a4 A G 16: 29,479,854 S96P probably damaging Het
Bnc1 A T 7: 81,973,636 H614Q probably benign Het
C6 A G 15: 4,759,820 D249G probably damaging Het
Camta1 A T 4: 151,088,973 F977I probably damaging Het
Chil6 T C 3: 106,391,154 S188G possibly damaging Het
Cntrob A T 11: 69,320,963 L145Q probably damaging Het
Coro7 T C 16: 4,634,889 E306G probably damaging Het
Cpq T C 15: 33,497,202 S363P possibly damaging Het
Ctc1 A G 11: 69,027,862 probably null Het
Defb43 T A 14: 63,017,797 N26K probably benign Het
Dennd1a T C 2: 37,844,833 T41A probably benign Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Eml6 A G 11: 30,024,545 L11P probably damaging Het
Epha5 A G 5: 84,416,429 V26A probably benign Het
Fam13c A G 10: 70,551,735 D443G probably damaging Het
Fam227a G A 15: 79,637,134 L243F possibly damaging Het
Fat3 T G 9: 15,968,295 R3301S probably benign Het
Fbxw20 T C 9: 109,217,510 T461A probably benign Het
Fgf8 T A 19: 45,741,568 S61C probably damaging Het
Fgfrl1 A G 5: 108,705,005 E100G probably damaging Het
Gabra4 G A 5: 71,572,069 S456F possibly damaging Het
Gas6 T C 8: 13,470,317 E457G probably damaging Het
Gm156 A T 6: 129,775,835 N2K possibly damaging Het
Gpr33 G A 12: 52,024,208 S16L probably benign Het
Greb1l A C 18: 10,501,049 N393T possibly damaging Het
Gtpbp4 T C 13: 8,977,304 K492E probably benign Het
Hsf2bp A T 17: 31,987,404 L251* probably null Het
Hyal5 A T 6: 24,876,194 Q22L possibly damaging Het
Itih1 A T 14: 30,941,984 V114E possibly damaging Het
Jak3 T A 8: 71,681,535 I427N probably damaging Het
Jcad T C 18: 4,675,162 S975P probably benign Het
Kcng4 A G 8: 119,632,923 V238A probably damaging Het
Klb A G 5: 65,372,074 D315G probably damaging Het
Krt5 T C 15: 101,711,659 N208D probably benign Het
Lmo7 T A 14: 101,900,215 H551Q probably benign Het
Lrp8 G T 4: 107,859,971 G732V probably damaging Het
Lrrc38 A G 4: 143,369,983 D288G unknown Het
Lrrc4b GAGAAG GAG 7: 44,462,230 probably benign Het
Mas1 A G 17: 12,842,036 Y167H probably benign Het
Mcm8 A C 2: 132,842,742 I759L probably benign Het
Med13l G A 5: 118,761,322 D2148N probably damaging Het
Muc20 A T 16: 32,794,242 I255K probably benign Het
Myh1 A G 11: 67,213,447 N980S probably benign Het
Nap1l4 T A 7: 143,534,287 Q178L probably damaging Het
Ncapg T A 5: 45,699,910 L988Q probably damaging Het
Ncf2 A T 1: 152,830,372 H245L probably damaging Het
Neurl4 A G 11: 69,903,210 E164G possibly damaging Het
Nf1 G A 11: 79,412,745 R416H probably damaging Het
Obscn G A 11: 59,135,709 Q223* probably null Het
Olfr1394 T C 11: 49,160,848 I278T probably benign Het
Olfr1494 T A 19: 13,750,053 *316R probably null Het
Pcdhb16 T A 18: 37,479,662 N558K probably damaging Het
Pcnx2 A T 8: 125,815,683 M1253K possibly damaging Het
Pla2g4a A G 1: 149,922,081 V22A probably damaging Het
Plppr5 G A 3: 117,625,906 probably null Het
Pnpla2 T C 7: 141,459,432 S353P probably benign Het
Pom121 A T 5: 135,391,754 L271Q unknown Het
Prepl A T 17: 85,088,551 M1K probably null Het
Prr14l A G 5: 32,844,469 probably benign Het
Psmc3 C A 2: 91,057,844 P325T probably benign Het
Psme2b A G 11: 48,946,069 V17A probably damaging Het
Ptpro A G 6: 137,416,865 I23V probably benign Het
Rab31 A G 17: 65,772,504 probably null Het
Ranbp6 T A 19: 29,812,500 K151* probably null Het
Rbm12b1 A T 4: 12,146,304 I759L probably benign Het
Rgs5 T C 1: 169,676,856 I25T probably benign Het
Rnf213 T C 11: 119,480,895 V4842A probably damaging Het
Rtl9 A T X: 143,103,041 I1150F probably damaging Het
Scn1a A T 2: 66,328,425 W384R probably damaging Het
Sema5a C T 15: 32,681,619 P948L probably damaging Het
Slc26a3 G A 12: 31,465,778 R559Q probably damaging Het
Spata22 A G 11: 73,331,127 probably benign Het
Sptbn2 G T 19: 4,745,299 R1595L probably benign Het
Tfdp1 T C 8: 13,373,039 S315P possibly damaging Het
Tle1 A T 4: 72,120,226 V688E probably damaging Het
Tmem129 A T 5: 33,655,321 probably null Het
Tmprss11a G A 5: 86,431,843 T91I probably benign Het
Tnfsf14 A G 17: 57,190,807 Y142H probably damaging Het
Tph1 T C 7: 46,662,114 D68G probably benign Het
Ttn A T 2: 76,762,287 S12507T probably damaging Het
Tubgcp2 T A 7: 140,006,153 M408L probably benign Het
Usp34 A T 11: 23,364,503 H815L probably benign Het
Usp6nl G A 2: 6,441,519 R746H probably benign Het
Utp20 A G 10: 88,816,979 S358P probably benign Het
Vmn2r118 G A 17: 55,592,882 T674I probably damaging Het
Vmn2r8 A T 5: 108,802,383 H199Q probably benign Het
Vmn2r9 A G 5: 108,847,522 V420A probably benign Het
Vmn2r99 A T 17: 19,378,815 T254S probably benign Het
Zbed5 A G 5: 129,901,669 H132R possibly damaging Het
Zfp568 A G 7: 29,989,088 E25G probably damaging Het
Zfp951 T A 5: 104,817,000 I67L possibly damaging Het
Other mutations in Slc29a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Slc29a3 APN 10 60723817 missense possibly damaging 0.95
R1986:Slc29a3 UTSW 10 60723814 missense probably damaging 1.00
R2206:Slc29a3 UTSW 10 60715907 missense possibly damaging 0.87
R3891:Slc29a3 UTSW 10 60716261 nonsense probably null
R4734:Slc29a3 UTSW 10 60716326 missense probably benign 0.01
R4748:Slc29a3 UTSW 10 60716326 missense probably benign 0.01
R4749:Slc29a3 UTSW 10 60716326 missense probably benign 0.01
R5682:Slc29a3 UTSW 10 60716212 missense probably benign 0.00
R5938:Slc29a3 UTSW 10 60752784 unclassified probably benign
R6104:Slc29a3 UTSW 10 60721002 missense possibly damaging 0.77
R6405:Slc29a3 UTSW 10 60716026 missense probably damaging 0.98
R7341:Slc29a3 UTSW 10 60750658 missense probably benign 0.25
R7683:Slc29a3 UTSW 10 60716366 missense not run
RF009:Slc29a3 UTSW 10 60750561 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGAACTTGGAGGTCCATGG -3'
(R):5'- ATCCTGGGCTTAGAGGTTCC -3'

Sequencing Primer
(F):5'- CTTGGAGGTCCATGGAGAGC -3'
(R):5'- CAGGGCTTGGACTTTGCC -3'
Posted On2014-08-25