Incidental Mutation 'R1967:Usp34'
ID 219078
Institutional Source Beutler Lab
Gene Symbol Usp34
Ensembl Gene ENSMUSG00000056342
Gene Name ubiquitin specific peptidase 34
Synonyms Murr2, A530081C03Rik
MMRRC Submission 039980-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.831) question?
Stock # R1967 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 23256895-23440560 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 23314503 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 815 (H815L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180046]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000137823
AA Change: H815L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: H815L

DomainStartEndE-ValueType
low complexity region 489 500 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 591 610 N/A INTRINSIC
coiled coil region 626 671 N/A INTRINSIC
low complexity region 827 842 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1399 1410 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1751 1764 N/A INTRINSIC
low complexity region 1812 1824 N/A INTRINSIC
Pfam:UCH 1950 2293 7.6e-44 PFAM
Pfam:UCH_1 1951 2249 3.6e-22 PFAM
low complexity region 2542 2564 N/A INTRINSIC
low complexity region 2672 2679 N/A INTRINSIC
Blast:Drf_GBD 2943 3116 3e-53 BLAST
low complexity region 3344 3357 N/A INTRINSIC
coiled coil region 3371 3393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180046
AA Change: H796L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: H796L

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 571 590 N/A INTRINSIC
coiled coil region 607 652 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 1187 1198 N/A INTRINSIC
low complexity region 1379 1390 N/A INTRINSIC
low complexity region 1498 1512 N/A INTRINSIC
low complexity region 1731 1744 N/A INTRINSIC
low complexity region 1792 1804 N/A INTRINSIC
Pfam:UCH 1930 2273 2.3e-44 PFAM
Pfam:UCH_1 1931 2229 1.1e-22 PFAM
low complexity region 2522 2544 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Blast:Drf_GBD 2923 3096 2e-53 BLAST
low complexity region 3324 3337 N/A INTRINSIC
coiled coil region 3352 3374 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik A C 15: 37,439,842 (GRCm39) probably benign Het
Abca6 T C 11: 110,077,974 (GRCm39) I1278V probably benign Het
Adamts15 C T 9: 30,832,605 (GRCm39) W310* probably null Het
Adamts6 T A 13: 104,563,459 (GRCm39) C650* probably null Het
Akap3 G T 6: 126,842,061 (GRCm39) G227C probably benign Het
Alox12e A T 11: 70,208,682 (GRCm39) S457T probably benign Het
Angpt1 C A 15: 42,301,703 (GRCm39) C435F probably damaging Het
Anxa9 T C 3: 95,207,919 (GRCm39) Q207R probably benign Het
Aplnr A T 2: 84,967,950 (GRCm39) D325V probably benign Het
Art2b A C 7: 101,229,414 (GRCm39) F162V probably damaging Het
Atp13a4 A G 16: 29,298,672 (GRCm39) S96P probably damaging Het
Bnc1 A T 7: 81,623,384 (GRCm39) H614Q probably benign Het
C6 A G 15: 4,789,302 (GRCm39) D249G probably damaging Het
Camta1 A T 4: 151,173,430 (GRCm39) F977I probably damaging Het
Chil6 T C 3: 106,298,470 (GRCm39) S188G possibly damaging Het
Cntrob A T 11: 69,211,789 (GRCm39) L145Q probably damaging Het
Coro7 T C 16: 4,452,753 (GRCm39) E306G probably damaging Het
Cplane1 T G 15: 8,232,904 (GRCm39) V1141G probably benign Het
Cpq T C 15: 33,497,348 (GRCm39) S363P possibly damaging Het
Ctc1 A G 11: 68,918,688 (GRCm39) probably null Het
Defb43 T A 14: 63,255,246 (GRCm39) N26K probably benign Het
Dennd1a T C 2: 37,734,845 (GRCm39) T41A probably benign Het
Dnah11 A C 12: 117,880,523 (GRCm39) Y3866D probably damaging Het
Eml6 A G 11: 29,974,545 (GRCm39) L11P probably damaging Het
Epha5 A G 5: 84,564,288 (GRCm39) V26A probably benign Het
Fam13c A G 10: 70,387,565 (GRCm39) D443G probably damaging Het
Fam227a G A 15: 79,521,335 (GRCm39) L243F possibly damaging Het
Fat3 T G 9: 15,879,591 (GRCm39) R3301S probably benign Het
Fbxw20 T C 9: 109,046,578 (GRCm39) T461A probably benign Het
Fgf8 T A 19: 45,730,007 (GRCm39) S61C probably damaging Het
Fgfrl1 A G 5: 108,852,871 (GRCm39) E100G probably damaging Het
Gabra4 G A 5: 71,729,412 (GRCm39) S456F possibly damaging Het
Gas6 T C 8: 13,520,317 (GRCm39) E457G probably damaging Het
Gpr33 G A 12: 52,070,991 (GRCm39) S16L probably benign Het
Greb1l A C 18: 10,501,049 (GRCm39) N393T possibly damaging Het
Gtpbp4 T C 13: 9,027,340 (GRCm39) K492E probably benign Het
Hsf2bp A T 17: 32,206,378 (GRCm39) L251* probably null Het
Hyal5 A T 6: 24,876,193 (GRCm39) Q22L possibly damaging Het
Itih1 A T 14: 30,663,941 (GRCm39) V114E possibly damaging Het
Jak3 T A 8: 72,134,179 (GRCm39) I427N probably damaging Het
Jcad T C 18: 4,675,162 (GRCm39) S975P probably benign Het
Kcng4 A G 8: 120,359,662 (GRCm39) V238A probably damaging Het
Klb A G 5: 65,529,417 (GRCm39) D315G probably damaging Het
Klrh1 A T 6: 129,752,798 (GRCm39) N2K possibly damaging Het
Krt5 T C 15: 101,620,094 (GRCm39) N208D probably benign Het
Lmo7 T A 14: 102,137,651 (GRCm39) H551Q probably benign Het
Lrp8 G T 4: 107,717,168 (GRCm39) G732V probably damaging Het
Lrrc38 A G 4: 143,096,553 (GRCm39) D288G unknown Het
Lrrc4b GAGAAG GAG 7: 44,111,654 (GRCm39) probably benign Het
Mas1 A G 17: 13,060,923 (GRCm39) Y167H probably benign Het
Mcm8 A C 2: 132,684,662 (GRCm39) I759L probably benign Het
Med13l G A 5: 118,899,387 (GRCm39) D2148N probably damaging Het
Muc20 A T 16: 32,614,612 (GRCm39) I255K probably benign Het
Myh1 A G 11: 67,104,273 (GRCm39) N980S probably benign Het
Nap1l4 T A 7: 143,088,024 (GRCm39) Q178L probably damaging Het
Ncapg T A 5: 45,857,252 (GRCm39) L988Q probably damaging Het
Ncf2 A T 1: 152,706,123 (GRCm39) H245L probably damaging Het
Neurl4 A G 11: 69,794,036 (GRCm39) E164G possibly damaging Het
Nf1 G A 11: 79,303,571 (GRCm39) R416H probably damaging Het
Obscn G A 11: 59,026,535 (GRCm39) Q223* probably null Het
Or10q1 T A 19: 13,727,417 (GRCm39) *316R probably null Het
Or2o1 T C 11: 49,051,675 (GRCm39) I278T probably benign Het
Pcdhb16 T A 18: 37,612,715 (GRCm39) N558K probably damaging Het
Pcnx2 A T 8: 126,542,422 (GRCm39) M1253K possibly damaging Het
Pla2g4a A G 1: 149,797,832 (GRCm39) V22A probably damaging Het
Plppr5 G A 3: 117,419,555 (GRCm39) probably null Het
Pnpla2 T C 7: 141,039,345 (GRCm39) S353P probably benign Het
Pom121 A T 5: 135,420,608 (GRCm39) L271Q unknown Het
Prepl A T 17: 85,395,979 (GRCm39) M1K probably null Het
Prr14l A G 5: 33,001,813 (GRCm39) probably benign Het
Psmc3 C A 2: 90,888,189 (GRCm39) P325T probably benign Het
Psme2b A G 11: 48,836,896 (GRCm39) V17A probably damaging Het
Ptpro A G 6: 137,393,863 (GRCm39) I23V probably benign Het
Rab31 A G 17: 66,079,499 (GRCm39) probably null Het
Ranbp6 T A 19: 29,789,900 (GRCm39) K151* probably null Het
Rbm12b1 A T 4: 12,146,304 (GRCm39) I759L probably benign Het
Rgs5 T C 1: 169,504,425 (GRCm39) I25T probably benign Het
Rnf213 T C 11: 119,371,721 (GRCm39) V4842A probably damaging Het
Rtl9 A T X: 141,886,037 (GRCm39) I1150F probably damaging Het
Scn1a A T 2: 66,158,769 (GRCm39) W384R probably damaging Het
Sema5a C T 15: 32,681,765 (GRCm39) P948L probably damaging Het
Slc26a3 G A 12: 31,515,777 (GRCm39) R559Q probably damaging Het
Slc29a3 A G 10: 60,552,243 (GRCm39) V267A probably benign Het
Spata22 A G 11: 73,221,953 (GRCm39) probably benign Het
Spata31e2 T A 1: 26,722,454 (GRCm39) I909L probably benign Het
Sptbn2 G T 19: 4,795,327 (GRCm39) R1595L probably benign Het
Tfdp1 T C 8: 13,423,039 (GRCm39) S315P possibly damaging Het
Tle1 A T 4: 72,038,463 (GRCm39) V688E probably damaging Het
Tmem129 A T 5: 33,812,665 (GRCm39) probably null Het
Tmprss11a G A 5: 86,579,702 (GRCm39) T91I probably benign Het
Tnfsf14 A G 17: 57,497,807 (GRCm39) Y142H probably damaging Het
Tph1 T C 7: 46,311,538 (GRCm39) D68G probably benign Het
Ttn A T 2: 76,592,631 (GRCm39) S12507T probably damaging Het
Tubgcp2 T A 7: 139,586,066 (GRCm39) M408L probably benign Het
Usp6nl G A 2: 6,446,330 (GRCm39) R746H probably benign Het
Utp20 A G 10: 88,652,841 (GRCm39) S358P probably benign Het
Vmn2r118 G A 17: 55,899,882 (GRCm39) T674I probably damaging Het
Vmn2r8 A T 5: 108,950,249 (GRCm39) H199Q probably benign Het
Vmn2r9 A G 5: 108,995,388 (GRCm39) V420A probably benign Het
Vmn2r99 A T 17: 19,599,077 (GRCm39) T254S probably benign Het
Zbed5 A G 5: 129,930,510 (GRCm39) H132R possibly damaging Het
Zfp568 A G 7: 29,688,513 (GRCm39) E25G probably damaging Het
Zfp951 T A 5: 104,964,866 (GRCm39) I67L possibly damaging Het
Other mutations in Usp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL00477:Usp34 APN 11 23,418,879 (GRCm39) missense probably damaging 0.99
IGL01307:Usp34 APN 11 23,367,676 (GRCm39) missense probably damaging 0.99
IGL01313:Usp34 APN 11 23,423,206 (GRCm39) missense probably damaging 1.00
IGL01794:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01826:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01827:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01830:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01867:Usp34 APN 11 23,334,411 (GRCm39) missense possibly damaging 0.77
IGL01939:Usp34 APN 11 23,295,141 (GRCm39) splice site probably benign
IGL01977:Usp34 APN 11 23,402,661 (GRCm39) missense probably damaging 1.00
IGL01985:Usp34 APN 11 23,402,565 (GRCm39) missense probably damaging 1.00
IGL02011:Usp34 APN 11 23,421,554 (GRCm39) missense probably damaging 0.99
IGL02302:Usp34 APN 11 23,417,243 (GRCm39) missense possibly damaging 0.91
IGL02423:Usp34 APN 11 23,304,900 (GRCm39) missense probably benign 0.11
IGL02491:Usp34 APN 11 23,382,630 (GRCm39) missense probably damaging 0.98
IGL02532:Usp34 APN 11 23,320,291 (GRCm39) missense probably damaging 0.99
IGL02561:Usp34 APN 11 23,301,652 (GRCm39) missense probably benign 0.09
IGL02706:Usp34 APN 11 23,338,659 (GRCm39) splice site probably benign
IGL02891:Usp34 APN 11 23,437,166 (GRCm39) missense probably benign 0.09
IGL03079:Usp34 APN 11 23,382,247 (GRCm39) missense possibly damaging 0.48
IGL03089:Usp34 APN 11 23,396,958 (GRCm39) missense possibly damaging 0.84
IGL03175:Usp34 APN 11 23,438,686 (GRCm39) missense probably benign
IGL03256:Usp34 APN 11 23,370,090 (GRCm39) nonsense probably null
IGL03280:Usp34 APN 11 23,304,897 (GRCm39) missense probably damaging 1.00
IGL03289:Usp34 APN 11 23,343,818 (GRCm39) missense possibly damaging 0.94
IGL03408:Usp34 APN 11 23,396,957 (GRCm39) missense possibly damaging 0.92
Chub UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
Cicione UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R5571_Usp34_680 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5713_Usp34_003 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
Roebuck UTSW 11 23,436,810 (GRCm39) splice site probably benign
stoat UTSW 11 23,437,203 (GRCm39) missense
tunnelvision UTSW 11 23,396,968 (GRCm39) missense
I2288:Usp34 UTSW 11 23,382,473 (GRCm39) splice site probably benign
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0099:Usp34 UTSW 11 23,313,111 (GRCm39) missense probably damaging 1.00
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0403:Usp34 UTSW 11 23,283,838 (GRCm39) missense possibly damaging 0.82
R0432:Usp34 UTSW 11 23,351,505 (GRCm39) missense probably damaging 0.99
R0446:Usp34 UTSW 11 23,417,207 (GRCm39) missense probably damaging 0.97
R0455:Usp34 UTSW 11 23,396,741 (GRCm39) splice site probably benign
R0470:Usp34 UTSW 11 23,386,001 (GRCm39) missense possibly damaging 0.94
R0472:Usp34 UTSW 11 23,334,509 (GRCm39) splice site probably benign
R0512:Usp34 UTSW 11 23,401,997 (GRCm39) missense probably benign 0.04
R0557:Usp34 UTSW 11 23,353,848 (GRCm39) missense probably damaging 0.98
R0562:Usp34 UTSW 11 23,382,406 (GRCm39) splice site probably benign
R0656:Usp34 UTSW 11 23,422,967 (GRCm39) missense probably damaging 0.99
R0693:Usp34 UTSW 11 23,402,637 (GRCm39) missense probably damaging 0.97
R0739:Usp34 UTSW 11 23,417,243 (GRCm39) missense possibly damaging 0.91
R1061:Usp34 UTSW 11 23,334,420 (GRCm39) missense possibly damaging 0.51
R1078:Usp34 UTSW 11 23,383,175 (GRCm39) splice site probably benign
R1223:Usp34 UTSW 11 23,396,464 (GRCm39) splice site probably null
R1295:Usp34 UTSW 11 23,334,477 (GRCm39) missense probably damaging 1.00
R1430:Usp34 UTSW 11 23,409,151 (GRCm39) missense probably damaging 0.97
R1445:Usp34 UTSW 11 23,301,629 (GRCm39) missense probably damaging 0.99
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1471:Usp34 UTSW 11 23,438,862 (GRCm39) missense probably benign 0.20
R1475:Usp34 UTSW 11 23,423,253 (GRCm39) missense probably damaging 0.99
R1628:Usp34 UTSW 11 23,438,725 (GRCm39) missense probably damaging 1.00
R1631:Usp34 UTSW 11 23,410,651 (GRCm39) missense probably damaging 0.99
R1655:Usp34 UTSW 11 23,325,051 (GRCm39) missense probably benign 0.05
R1741:Usp34 UTSW 11 23,314,103 (GRCm39) missense probably benign 0.00
R1854:Usp34 UTSW 11 23,376,153 (GRCm39) missense probably benign 0.24
R1867:Usp34 UTSW 11 23,311,593 (GRCm39) missense possibly damaging 0.82
R1869:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1870:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1871:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R2051:Usp34 UTSW 11 23,414,468 (GRCm39) missense probably damaging 0.97
R2132:Usp34 UTSW 11 23,414,556 (GRCm39) missense possibly damaging 0.95
R2156:Usp34 UTSW 11 23,332,602 (GRCm39) missense probably damaging 0.98
R2205:Usp34 UTSW 11 23,335,147 (GRCm39) missense probably damaging 0.97
R2342:Usp34 UTSW 11 23,353,599 (GRCm39) missense possibly damaging 0.46
R3431:Usp34 UTSW 11 23,320,466 (GRCm39) missense possibly damaging 0.95
R3812:Usp34 UTSW 11 23,414,517 (GRCm39) missense possibly damaging 0.94
R3872:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3873:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3874:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3875:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3925:Usp34 UTSW 11 23,293,640 (GRCm39) missense probably benign 0.28
R3972:Usp34 UTSW 11 23,407,803 (GRCm39) missense probably damaging 1.00
R4018:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4042:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4155:Usp34 UTSW 11 23,367,676 (GRCm39) missense probably damaging 0.99
R4197:Usp34 UTSW 11 23,394,189 (GRCm39) missense probably damaging 0.98
R4352:Usp34 UTSW 11 23,270,727 (GRCm39) missense possibly damaging 0.73
R4379:Usp34 UTSW 11 23,334,499 (GRCm39) missense possibly damaging 0.52
R4444:Usp34 UTSW 11 23,385,998 (GRCm39) missense probably damaging 0.98
R4475:Usp34 UTSW 11 23,407,975 (GRCm39) missense possibly damaging 0.95
R4501:Usp34 UTSW 11 23,351,529 (GRCm39) missense probably damaging 1.00
R4527:Usp34 UTSW 11 23,371,257 (GRCm39) missense possibly damaging 0.57
R4603:Usp34 UTSW 11 23,414,633 (GRCm39) missense probably damaging 0.97
R4612:Usp34 UTSW 11 23,382,268 (GRCm39) missense probably damaging 0.99
R4673:Usp34 UTSW 11 23,314,480 (GRCm39) small deletion probably benign
R4707:Usp34 UTSW 11 23,437,215 (GRCm39) missense probably damaging 1.00
R4736:Usp34 UTSW 11 23,343,749 (GRCm39) splice site probably null
R4867:Usp34 UTSW 11 23,401,999 (GRCm39) missense probably benign 0.28
R4879:Usp34 UTSW 11 23,323,410 (GRCm39) missense possibly damaging 0.94
R4977:Usp34 UTSW 11 23,438,982 (GRCm39) missense probably damaging 1.00
R5004:Usp34 UTSW 11 23,414,586 (GRCm39) missense probably damaging 1.00
R5057:Usp34 UTSW 11 23,408,086 (GRCm39) intron probably benign
R5068:Usp34 UTSW 11 23,410,665 (GRCm39) missense possibly damaging 0.94
R5304:Usp34 UTSW 11 23,293,616 (GRCm39) missense probably damaging 1.00
R5320:Usp34 UTSW 11 23,283,739 (GRCm39) missense probably benign
R5327:Usp34 UTSW 11 23,418,846 (GRCm39) missense probably damaging 1.00
R5328:Usp34 UTSW 11 23,438,659 (GRCm39) missense probably benign 0.04
R5328:Usp34 UTSW 11 23,414,616 (GRCm39) missense probably benign 0.01
R5390:Usp34 UTSW 11 23,394,202 (GRCm39) critical splice donor site probably null
R5434:Usp34 UTSW 11 23,362,271 (GRCm39) missense probably damaging 0.99
R5523:Usp34 UTSW 11 23,299,198 (GRCm39) missense probably benign 0.39
R5567:Usp34 UTSW 11 23,438,336 (GRCm39) missense probably damaging 0.97
R5571:Usp34 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5645:Usp34 UTSW 11 23,325,024 (GRCm39) missense possibly damaging 0.86
R5713:Usp34 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
R5719:Usp34 UTSW 11 23,304,846 (GRCm39) missense probably benign 0.00
R5813:Usp34 UTSW 11 23,371,340 (GRCm39) missense probably benign 0.38
R5921:Usp34 UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
R5928:Usp34 UTSW 11 23,386,040 (GRCm39) missense probably damaging 0.98
R5944:Usp34 UTSW 11 23,313,089 (GRCm39) missense probably damaging 1.00
R6198:Usp34 UTSW 11 23,434,127 (GRCm39) missense probably damaging 1.00
R6229:Usp34 UTSW 11 23,396,778 (GRCm39) missense probably damaging 0.99
R6306:Usp34 UTSW 11 23,362,260 (GRCm39) missense possibly damaging 0.94
R6320:Usp34 UTSW 11 23,402,520 (GRCm39) missense probably damaging 0.98
R6341:Usp34 UTSW 11 23,331,353 (GRCm39) missense probably damaging 0.97
R6374:Usp34 UTSW 11 23,388,914 (GRCm39) missense probably damaging 1.00
R6398:Usp34 UTSW 11 23,438,666 (GRCm39) missense probably benign
R6438:Usp34 UTSW 11 23,314,266 (GRCm39) missense probably benign 0.02
R6668:Usp34 UTSW 11 23,410,659 (GRCm39) missense probably damaging 0.97
R6700:Usp34 UTSW 11 23,389,011 (GRCm39) missense probably damaging 1.00
R6783:Usp34 UTSW 11 23,362,318 (GRCm39) missense probably damaging 1.00
R6821:Usp34 UTSW 11 23,317,491 (GRCm39) missense possibly damaging 0.79
R6855:Usp34 UTSW 11 23,402,569 (GRCm39) missense possibly damaging 0.94
R6916:Usp34 UTSW 11 23,408,023 (GRCm39) missense probably damaging 0.98
R7020:Usp34 UTSW 11 23,343,954 (GRCm39) missense probably benign 0.05
R7026:Usp34 UTSW 11 23,311,622 (GRCm39) missense probably damaging 1.00
R7085:Usp34 UTSW 11 23,313,097 (GRCm39) missense
R7101:Usp34 UTSW 11 23,376,183 (GRCm39) missense
R7168:Usp34 UTSW 11 23,414,585 (GRCm39) missense
R7192:Usp34 UTSW 11 23,410,571 (GRCm39) missense
R7264:Usp34 UTSW 11 23,283,566 (GRCm39) missense probably benign 0.00
R7325:Usp34 UTSW 11 23,369,052 (GRCm39) missense
R7343:Usp34 UTSW 11 23,438,868 (GRCm39) missense
R7358:Usp34 UTSW 11 23,311,683 (GRCm39) missense probably damaging 0.99
R7369:Usp34 UTSW 11 23,382,361 (GRCm39) missense
R7389:Usp34 UTSW 11 23,295,200 (GRCm39) missense
R7459:Usp34 UTSW 11 23,314,458 (GRCm39) missense possibly damaging 0.53
R7517:Usp34 UTSW 11 23,396,968 (GRCm39) missense
R7729:Usp34 UTSW 11 23,399,268 (GRCm39) missense
R7777:Usp34 UTSW 11 23,332,638 (GRCm39) missense
R7810:Usp34 UTSW 11 23,362,314 (GRCm39) missense
R7836:Usp34 UTSW 11 23,396,614 (GRCm39) missense
R7862:Usp34 UTSW 11 23,414,718 (GRCm39) missense
R7993:Usp34 UTSW 11 23,327,622 (GRCm39) missense
R8050:Usp34 UTSW 11 23,396,787 (GRCm39) missense
R8054:Usp34 UTSW 11 23,311,295 (GRCm39) missense
R8239:Usp34 UTSW 11 23,396,750 (GRCm39) missense
R8266:Usp34 UTSW 11 23,436,810 (GRCm39) splice site probably benign
R8347:Usp34 UTSW 11 23,362,345 (GRCm39) missense
R8409:Usp34 UTSW 11 23,407,811 (GRCm39) missense
R8692:Usp34 UTSW 11 23,379,325 (GRCm39) missense
R8694:Usp34 UTSW 11 23,434,161 (GRCm39) missense
R8734:Usp34 UTSW 11 23,394,184 (GRCm39) missense
R8806:Usp34 UTSW 11 23,434,143 (GRCm39) missense
R8914:Usp34 UTSW 11 23,293,604 (GRCm39) missense
R8987:Usp34 UTSW 11 23,414,267 (GRCm39) missense
R9013:Usp34 UTSW 11 23,320,302 (GRCm39) missense
R9108:Usp34 UTSW 11 23,320,528 (GRCm39) missense
R9264:Usp34 UTSW 11 23,439,064 (GRCm39) missense
R9301:Usp34 UTSW 11 23,422,951 (GRCm39) missense
R9375:Usp34 UTSW 11 23,437,203 (GRCm39) missense
R9385:Usp34 UTSW 11 23,399,223 (GRCm39) missense
R9500:Usp34 UTSW 11 23,331,337 (GRCm39) missense probably damaging 0.99
R9566:Usp34 UTSW 11 23,317,529 (GRCm39) missense
R9629:Usp34 UTSW 11 23,314,364 (GRCm39) missense
R9679:Usp34 UTSW 11 23,394,369 (GRCm39) missense
R9680:Usp34 UTSW 11 23,317,385 (GRCm39) missense possibly damaging 0.94
R9686:Usp34 UTSW 11 23,424,351 (GRCm39) missense
R9752:Usp34 UTSW 11 23,409,182 (GRCm39) missense probably benign 0.11
X0023:Usp34 UTSW 11 23,325,028 (GRCm39) missense possibly damaging 0.73
X0057:Usp34 UTSW 11 23,407,824 (GRCm39) missense possibly damaging 0.86
Z1176:Usp34 UTSW 11 23,423,221 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGCACAAGGTTCTCAGGAG -3'
(R):5'- GGAGTGAACCAAGACCTTTGAG -3'

Sequencing Primer
(F):5'- TCTCAGGAGGCTTGTATCACACG -3'
(R):5'- CTTTGAGGTACACTAGCAACAATC -3'
Posted On 2014-08-25