Incidental Mutation 'R1967:Cntrob'
ID 219085
Institutional Source Beutler Lab
Gene Symbol Cntrob
Ensembl Gene ENSMUSG00000032782
Gene Name centrobin, centrosomal BRCA2 interacting protein
Synonyms Nip2, 9830165K03Rik, Lip8
MMRRC Submission 039980-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.175) question?
Stock # R1967 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 69190313-69214601 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 69211789 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 145 (L145Q)
Ref Sequence ENSEMBL: ENSMUSP00000090651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060956] [ENSMUST00000092973] [ENSMUST00000102601] [ENSMUST00000102602] [ENSMUST00000108662] [ENSMUST00000123176]
AlphaFold Q8CB62
Predicted Effect probably benign
Transcript: ENSMUST00000060956
SMART Domains Protein: ENSMUSP00000050153
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 109 2.2e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092973
AA Change: L145Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090651
Gene: ENSMUSG00000032782
AA Change: L145Q

DomainStartEndE-ValueType
coiled coil region 191 218 N/A INTRINSIC
coiled coil region 249 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102601
SMART Domains Protein: ENSMUSP00000099661
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 137 1.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102602
SMART Domains Protein: ENSMUSP00000099662
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 137 1.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108662
SMART Domains Protein: ENSMUSP00000104302
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 127 2.2e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123176
AA Change: C117S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176111
Predicted Effect probably benign
Transcript: ENSMUST00000176938
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein that interacts with BRCA2, and is required for centriole duplication and cytokinesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik A C 15: 37,439,842 (GRCm39) probably benign Het
Abca6 T C 11: 110,077,974 (GRCm39) I1278V probably benign Het
Adamts15 C T 9: 30,832,605 (GRCm39) W310* probably null Het
Adamts6 T A 13: 104,563,459 (GRCm39) C650* probably null Het
Akap3 G T 6: 126,842,061 (GRCm39) G227C probably benign Het
Alox12e A T 11: 70,208,682 (GRCm39) S457T probably benign Het
Angpt1 C A 15: 42,301,703 (GRCm39) C435F probably damaging Het
Anxa9 T C 3: 95,207,919 (GRCm39) Q207R probably benign Het
Aplnr A T 2: 84,967,950 (GRCm39) D325V probably benign Het
Art2b A C 7: 101,229,414 (GRCm39) F162V probably damaging Het
Atp13a4 A G 16: 29,298,672 (GRCm39) S96P probably damaging Het
Bnc1 A T 7: 81,623,384 (GRCm39) H614Q probably benign Het
C6 A G 15: 4,789,302 (GRCm39) D249G probably damaging Het
Camta1 A T 4: 151,173,430 (GRCm39) F977I probably damaging Het
Chil6 T C 3: 106,298,470 (GRCm39) S188G possibly damaging Het
Coro7 T C 16: 4,452,753 (GRCm39) E306G probably damaging Het
Cplane1 T G 15: 8,232,904 (GRCm39) V1141G probably benign Het
Cpq T C 15: 33,497,348 (GRCm39) S363P possibly damaging Het
Ctc1 A G 11: 68,918,688 (GRCm39) probably null Het
Defb43 T A 14: 63,255,246 (GRCm39) N26K probably benign Het
Dennd1a T C 2: 37,734,845 (GRCm39) T41A probably benign Het
Dnah11 A C 12: 117,880,523 (GRCm39) Y3866D probably damaging Het
Eml6 A G 11: 29,974,545 (GRCm39) L11P probably damaging Het
Epha5 A G 5: 84,564,288 (GRCm39) V26A probably benign Het
Fam13c A G 10: 70,387,565 (GRCm39) D443G probably damaging Het
Fam227a G A 15: 79,521,335 (GRCm39) L243F possibly damaging Het
Fat3 T G 9: 15,879,591 (GRCm39) R3301S probably benign Het
Fbxw20 T C 9: 109,046,578 (GRCm39) T461A probably benign Het
Fgf8 T A 19: 45,730,007 (GRCm39) S61C probably damaging Het
Fgfrl1 A G 5: 108,852,871 (GRCm39) E100G probably damaging Het
Gabra4 G A 5: 71,729,412 (GRCm39) S456F possibly damaging Het
Gas6 T C 8: 13,520,317 (GRCm39) E457G probably damaging Het
Gpr33 G A 12: 52,070,991 (GRCm39) S16L probably benign Het
Greb1l A C 18: 10,501,049 (GRCm39) N393T possibly damaging Het
Gtpbp4 T C 13: 9,027,340 (GRCm39) K492E probably benign Het
Hsf2bp A T 17: 32,206,378 (GRCm39) L251* probably null Het
Hyal5 A T 6: 24,876,193 (GRCm39) Q22L possibly damaging Het
Itih1 A T 14: 30,663,941 (GRCm39) V114E possibly damaging Het
Jak3 T A 8: 72,134,179 (GRCm39) I427N probably damaging Het
Jcad T C 18: 4,675,162 (GRCm39) S975P probably benign Het
Kcng4 A G 8: 120,359,662 (GRCm39) V238A probably damaging Het
Klb A G 5: 65,529,417 (GRCm39) D315G probably damaging Het
Klrh1 A T 6: 129,752,798 (GRCm39) N2K possibly damaging Het
Krt5 T C 15: 101,620,094 (GRCm39) N208D probably benign Het
Lmo7 T A 14: 102,137,651 (GRCm39) H551Q probably benign Het
Lrp8 G T 4: 107,717,168 (GRCm39) G732V probably damaging Het
Lrrc38 A G 4: 143,096,553 (GRCm39) D288G unknown Het
Lrrc4b GAGAAG GAG 7: 44,111,654 (GRCm39) probably benign Het
Mas1 A G 17: 13,060,923 (GRCm39) Y167H probably benign Het
Mcm8 A C 2: 132,684,662 (GRCm39) I759L probably benign Het
Med13l G A 5: 118,899,387 (GRCm39) D2148N probably damaging Het
Muc20 A T 16: 32,614,612 (GRCm39) I255K probably benign Het
Myh1 A G 11: 67,104,273 (GRCm39) N980S probably benign Het
Nap1l4 T A 7: 143,088,024 (GRCm39) Q178L probably damaging Het
Ncapg T A 5: 45,857,252 (GRCm39) L988Q probably damaging Het
Ncf2 A T 1: 152,706,123 (GRCm39) H245L probably damaging Het
Neurl4 A G 11: 69,794,036 (GRCm39) E164G possibly damaging Het
Nf1 G A 11: 79,303,571 (GRCm39) R416H probably damaging Het
Obscn G A 11: 59,026,535 (GRCm39) Q223* probably null Het
Or10q1 T A 19: 13,727,417 (GRCm39) *316R probably null Het
Or2o1 T C 11: 49,051,675 (GRCm39) I278T probably benign Het
Pcdhb16 T A 18: 37,612,715 (GRCm39) N558K probably damaging Het
Pcnx2 A T 8: 126,542,422 (GRCm39) M1253K possibly damaging Het
Pla2g4a A G 1: 149,797,832 (GRCm39) V22A probably damaging Het
Plppr5 G A 3: 117,419,555 (GRCm39) probably null Het
Pnpla2 T C 7: 141,039,345 (GRCm39) S353P probably benign Het
Pom121 A T 5: 135,420,608 (GRCm39) L271Q unknown Het
Prepl A T 17: 85,395,979 (GRCm39) M1K probably null Het
Prr14l A G 5: 33,001,813 (GRCm39) probably benign Het
Psmc3 C A 2: 90,888,189 (GRCm39) P325T probably benign Het
Psme2b A G 11: 48,836,896 (GRCm39) V17A probably damaging Het
Ptpro A G 6: 137,393,863 (GRCm39) I23V probably benign Het
Rab31 A G 17: 66,079,499 (GRCm39) probably null Het
Ranbp6 T A 19: 29,789,900 (GRCm39) K151* probably null Het
Rbm12b1 A T 4: 12,146,304 (GRCm39) I759L probably benign Het
Rgs5 T C 1: 169,504,425 (GRCm39) I25T probably benign Het
Rnf213 T C 11: 119,371,721 (GRCm39) V4842A probably damaging Het
Rtl9 A T X: 141,886,037 (GRCm39) I1150F probably damaging Het
Scn1a A T 2: 66,158,769 (GRCm39) W384R probably damaging Het
Sema5a C T 15: 32,681,765 (GRCm39) P948L probably damaging Het
Slc26a3 G A 12: 31,515,777 (GRCm39) R559Q probably damaging Het
Slc29a3 A G 10: 60,552,243 (GRCm39) V267A probably benign Het
Spata22 A G 11: 73,221,953 (GRCm39) probably benign Het
Spata31e2 T A 1: 26,722,454 (GRCm39) I909L probably benign Het
Sptbn2 G T 19: 4,795,327 (GRCm39) R1595L probably benign Het
Tfdp1 T C 8: 13,423,039 (GRCm39) S315P possibly damaging Het
Tle1 A T 4: 72,038,463 (GRCm39) V688E probably damaging Het
Tmem129 A T 5: 33,812,665 (GRCm39) probably null Het
Tmprss11a G A 5: 86,579,702 (GRCm39) T91I probably benign Het
Tnfsf14 A G 17: 57,497,807 (GRCm39) Y142H probably damaging Het
Tph1 T C 7: 46,311,538 (GRCm39) D68G probably benign Het
Ttn A T 2: 76,592,631 (GRCm39) S12507T probably damaging Het
Tubgcp2 T A 7: 139,586,066 (GRCm39) M408L probably benign Het
Usp34 A T 11: 23,314,503 (GRCm39) H815L probably benign Het
Usp6nl G A 2: 6,446,330 (GRCm39) R746H probably benign Het
Utp20 A G 10: 88,652,841 (GRCm39) S358P probably benign Het
Vmn2r118 G A 17: 55,899,882 (GRCm39) T674I probably damaging Het
Vmn2r8 A T 5: 108,950,249 (GRCm39) H199Q probably benign Het
Vmn2r9 A G 5: 108,995,388 (GRCm39) V420A probably benign Het
Vmn2r99 A T 17: 19,599,077 (GRCm39) T254S probably benign Het
Zbed5 A G 5: 129,930,510 (GRCm39) H132R possibly damaging Het
Zfp568 A G 7: 29,688,513 (GRCm39) E25G probably damaging Het
Zfp951 T A 5: 104,964,866 (GRCm39) I67L possibly damaging Het
Other mutations in Cntrob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02975:Cntrob APN 11 69,210,199 (GRCm39) missense possibly damaging 0.66
IGL03173:Cntrob APN 11 69,200,853 (GRCm39) missense possibly damaging 0.90
groats UTSW 11 69,200,317 (GRCm39) nonsense probably null
BB005:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
BB015:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R0270:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R0501:Cntrob UTSW 11 69,213,694 (GRCm39) missense probably damaging 1.00
R1749:Cntrob UTSW 11 69,213,700 (GRCm39) missense probably damaging 0.99
R1775:Cntrob UTSW 11 69,211,693 (GRCm39) missense possibly damaging 0.90
R1900:Cntrob UTSW 11 69,198,880 (GRCm39) missense probably benign 0.27
R2495:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R3121:Cntrob UTSW 11 69,213,526 (GRCm39) nonsense probably null
R3780:Cntrob UTSW 11 69,193,708 (GRCm39) missense probably damaging 0.97
R4449:Cntrob UTSW 11 69,196,375 (GRCm39) missense probably benign 0.29
R4696:Cntrob UTSW 11 69,211,714 (GRCm39) missense probably damaging 1.00
R4841:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4842:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4908:Cntrob UTSW 11 69,211,732 (GRCm39) missense probably damaging 0.97
R4982:Cntrob UTSW 11 69,202,188 (GRCm39) splice site probably null
R5168:Cntrob UTSW 11 69,190,816 (GRCm39) missense possibly damaging 0.66
R5187:Cntrob UTSW 11 69,212,717 (GRCm39) missense possibly damaging 0.62
R5307:Cntrob UTSW 11 69,205,576 (GRCm39) missense possibly damaging 0.66
R5473:Cntrob UTSW 11 69,213,579 (GRCm39) missense possibly damaging 0.81
R5903:Cntrob UTSW 11 69,200,201 (GRCm39) missense possibly damaging 0.83
R6643:Cntrob UTSW 11 69,202,248 (GRCm39) missense possibly damaging 0.46
R6742:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R6964:Cntrob UTSW 11 69,200,317 (GRCm39) nonsense probably null
R7020:Cntrob UTSW 11 69,193,918 (GRCm39) critical splice donor site probably null
R7425:Cntrob UTSW 11 69,205,560 (GRCm39) nonsense probably null
R7928:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R7946:Cntrob UTSW 11 69,206,047 (GRCm39) missense possibly damaging 0.82
R8348:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8448:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8539:Cntrob UTSW 11 69,211,652 (GRCm39) missense possibly damaging 0.94
R9259:Cntrob UTSW 11 69,211,665 (GRCm39) missense possibly damaging 0.81
R9415:Cntrob UTSW 11 69,193,741 (GRCm39) missense possibly damaging 0.66
R9553:Cntrob UTSW 11 69,205,679 (GRCm39) missense probably benign 0.00
R9626:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R9628:Cntrob UTSW 11 69,213,782 (GRCm39) missense possibly damaging 0.66
R9801:Cntrob UTSW 11 69,212,233 (GRCm39) missense possibly damaging 0.82
Z1177:Cntrob UTSW 11 69,202,275 (GRCm39) missense possibly damaging 0.66
Z1186:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1186:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1187:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1187:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1188:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1188:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1189:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1189:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1190:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1190:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1191:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1191:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1192:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1192:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCTTATCCATCAGACTTGC -3'
(R):5'- TAGGCCTCATTGTAGGGGAG -3'

Sequencing Primer
(F):5'- AGACTTGCTTCTCTACCCAAGG -3'
(R):5'- CCTCATTGTAGGGGAGTGGTTG -3'
Posted On 2014-08-25